Glyma18g45356 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g45356

Feature Type:	gene_model
Chromosome:	Gm18
Start:	55128762
stop:	55131011
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g45356

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G01960	AT	Annotation by Michelle Graham. TAIR10: SEC7-like guanine nucleotide exchange family protein \| chr1:330830-337582 REVERSE LENGTH=1750	SoyBase	E_val: 5.00E-124	ISS
GO:0009561	GO-bp	Annotation by Michelle Graham. GO Biological Process: megagametogenesis	SoyBase	N/A	ISS
GO:0016192	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport	SoyBase	N/A	ISS
GO:0032012	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of ARF protein signal transduction	SoyBase	N/A	ISS
GO:0050790	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of catalytic activity	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005085	GO-mf	Annotation by Michelle Graham. GO Molecular Function: guanyl-nucleotide exchange factor activity	SoyBase	N/A	ISS
GO:0005086	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ARF guanyl-nucleotide exchange factor activity	SoyBase	N/A	ISS
PTHR10663	Panther	GUANYL-NUCLEOTIDE EXCHANGE FACTOR	JGI		ISS
PTHR10663:SF42	Panther	SEC7 DOMAIN PROTEIN	JGI		ISS
PF01369	PFAM	Sec7 domain	JGI		ISS
UniRef100_G7L099	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Brefeldin A-inhibited guanine nucleotide-exchange protein n=1 Tax=Medicago truncatula RepID=G7L099_MEDTR	SoyBase	E_val: 3.00E-128	ISS
UniRef100_I1L6U0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L6U0_SOYBN	SoyBase	E_val: 1.00E-138	ISS

Expression Patterns of Glyma18g45356

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g45356 not represented in the dataset	Glyma18g45356 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g45356 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g221400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g45356

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g45356

Limit To All Plant Sequences

>Glyma18g45356.1   sequence type=CDS   gene model=Glyma18g45356   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGTATGGCTTTGCCTCTTGGGCCTTGCTGTTTGTAACTCCTTATTGCTATTCATATCAGAATTCCTCATCAATGCCAACAAAGTGGGTAATTCACCAGAGGAAATAGCTGCTTTTCTTAAAGATGCATCTGGGTTGAACAAGACTTTCATTGGTGATTATCTAGGAGAAAGGGAAGAGTTATCCTTGAAAGTAATGCATGCATATGTGGATTCTTTTGACTTTCAAGGGATGGAGTTTGATGAGGCAATCAGGGCCTTTCTTCAAGGCTTTAGATTGCCTGGTGAGGCACAGAAAATTGATCGAATCATGGAAAAGTTTGCAGAACGATATTGCAAATGTAATCCAAAAGTCTTTTCTAGTGCTGATACAGCATATGTCCTTGCATATTCTGTGATACTGCTTAATACCGATGCCCACAATCCTATGGTGAAAAACAAGATGTCGGCTGAAGATTTCATAAAAAATAATCGTGGCATAGATGATGGAAAAGATGTACCAGAGGAATACTTAAGGTCTTTGTATGAACGGATATCTAGAAATGAGATCAAAATGAAAGAAGTTGATCTGGAATCCCAGCAAAAACAGGCTGTGAACTCTAACAGACTTTCAGGCTTGGATAGTATATTGAATATTGTGGTCCGGAAGCATGGGGAAGACAGTAATATGGAGACCAGTGATGATCGAATCCAACATATGCAAGAACAATTCAAATAA

Predicted protein sequences of Glyma18g45356

Limit To All Plant Sequences

>Glyma18g45356.1   sequence type=predicted peptide   gene model=Glyma18g45356   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVWLCLLGLAVCNSLLLFISEFLINANKVGNSPEEIAAFLKDASGLNKTFIGDYLGEREELSLKVMHAYVDSFDFQGMEFDEAIRAFLQGFRLPGEAQKIDRIMEKFAERYCKCNPKVFSSADTAYVLAYSVILLNTDAHNPMVKNKMSAEDFIKNNRGIDDGKDVPEEYLRSLYERISRNEIKMKEVDLESQQKQAVNSNRLSGLDSILNIVVRKHGEDSNMETSDDRIQHMQEQFK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain