Glyma18g45350 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g45350

Feature Type:	gene_model
Chromosome:	Gm18
Start:	55123761
stop:	55125196
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g45350

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G24620	AT	Annotation by Michelle Graham. TAIR10: EF hand calcium-binding protein family \| chr1:8723893-8724453 REVERSE LENGTH=186	SoyBase	E_val: 3.00E-28	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0048610	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular process involved in reproduction	SoyBase	N/A	ISS
GO:0048767	GO-bp	Annotation by Michelle Graham. GO Biological Process: root hair elongation	SoyBase	N/A	ISS
GO:0048868	GO-bp	Annotation by Michelle Graham. GO Biological Process: pollen tube development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
KOG0027	KOG	Calmodulin and related proteins (EF-Hand superfamily)	JGI		ISS
PTHR10891	Panther	CALMODULIN	JGI		ISS
PTHR10891:SF39	Panther	EF-HAND CALCIUM BINDING PROTEIN	JGI		ISS
PF00036	PFAM	EF hand	JGI		ISS
UniRef100_G7L0A0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Calcium-binding protein CML24 n=1 Tax=Medicago truncatula RepID=G7L0A0_MEDTR	SoyBase	E_val: 1.00E-76	ISS
UniRef100_I1N3F4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N3F4_SOYBN	SoyBase	E_val: 1.00E-159	ISS

Expression Patterns of Glyma18g45350

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g45350 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g221300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g45350

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g45350

Limit To All Plant Sequences

>Glyma18g45350.1   sequence type=CDS   gene model=Glyma18g45350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGCAACCCTTCACTACTTGCTTCACCTTTCTTCATAGGAAGACCAAATTCTTCCTCAATAAACCAAGAATCAAGGACATGATGAGTGCATGCCGCAAGAGGAGACAATCCAACAGAAAATTCACTTCAAGTTCTGACTTGTCAACCTCTTCTTTCCTTCACATGGAGCTCTCTACTCAGTTTCATCAAGTTTTCAAGCTTATCGACACTAATGGGGATGGGAAGATATCAGCTACTGAGCTCAGTGAAGTGCTCTCATGCCTTGGATACAACAAGTGCACTGCTGACAAGGAAGCTGAAGGCATGGTGAGAGTGTTGGACTTCAATGGAGATGGGTTTGTGGACTTGGATGAGTTCATGATTGTCATGAATGGCATGGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAATTTGGAAGTGGCATGGAGCATGGTGGTGGTTACCTCATGGATGCTTTTCTTATCTTTGACACTGACAAGAATGGCTTAATTTCAGCCAAGGAACTGCAGAGAGTTCTGATCAATCTAGGGTGTGATAATTGTAGTCTTAGAGAGTGCAAGCGCATGATCAAAGGGGTTGATAAAAATGGAGATGGGTTCGTGGATTTTGAAGAGTTTCTATCCATGATGCAAAGTGGACTTGCCAATTAG

Predicted protein sequences of Glyma18g45350

Limit To All Plant Sequences

>Glyma18g45350.1   sequence type=predicted peptide   gene model=Glyma18g45350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLQPFTTCFTFLHRKTKFFLNKPRIKDMMSACRKRRQSNRKFTSSSDLSTSSFLHMELSTQFHQVFKLIDTNGDGKISATELSEVLSCLGYNKCTADKEAEGMVRVLDFNGDGFVDLDEFMIVMNGMEEEEEEEEEEEEEEEEKFGSGMEHGGGYLMDAFLIFDTDKNGLISAKELQRVLINLGCDNCSLRECKRMIKGVDKNGDGFVDFEEFLSMMQSGLAN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain