Glyma18g45290 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g45290

Feature Type:	gene_model
Chromosome:	Gm18
Start:	55056112
stop:	55059094
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g45290

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G12390	AT	Annotation by Michelle Graham. TAIR10: Cornichon family protein \| chr1:4220347-4221481 FORWARD LENGTH=137	SoyBase	E_val: 6.00E-49	ISS
GO:0035556	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG2729	KOG	ER vesicle integral membrane protein involved in establishing cell polarity, signaling and protein degradation	JGI		ISS
PTHR12290	Panther	CORNICHON	JGI		ISS
PTHR12290:SF5	Panther	CORNICHON-RELATED	JGI		ISS
PF03311	PFAM	Cornichon protein	JGI		ISS
UniRef100_C6SYL0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=2 Tax=Glycine max RepID=C6SYL0_SOYBN	SoyBase	E_val: 6.00E-92	ISS
UniRef100_Q84W04	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein cornichon homolog 4 n=1 Tax=Arabidopsis thaliana RepID=CNIH4_ARATH	SoyBase	E_val: 3.00E-46	ISS

Expression Patterns of Glyma18g45290

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g45290

Paralog	Evidence	Comments
Glyma09g40530	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g45290 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g220800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g45290

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g45290

Limit To All Plant Sequences

>Glyma18g45290.2   sequence type=CDS   gene model=Glyma18g45290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGGAGGTGTTATATTGGATCTCAACGTTTGTTCTCATTTTGACTCTTCTTTGTATTCTCGGTTACCAGCTTATATTATTGGTGGACCTGGAGTTTGATTATATCAACCCATATGATTCCACGTCTCAGATAAACCAGGTTGTCTTGCCAGAGTTTATCATCCATGGAATCTTCTGCTTCACCAATCTTATAGCCGGGCATTGGTTTATATTCTTGATATCTCTCCCTTTCCTGTATTACAATCTGCGATTGTACATTAAAAGAGAGCACTTAGCAGATGTTACTGAAATCTACAATAAGCTAAATTGGGAGAAAAAGAAGCGGCTGTTCAAAGTTGCATATCTTGTTTTGGTATTTGCATTTTGTATAGTCAGCTTGGTATGGACCCTTACCGAGGATGTGCATTAA

Predicted protein sequences of Glyma18g45290

Limit To All Plant Sequences

>Glyma18g45290.2   sequence type=predicted peptide   gene model=Glyma18g45290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEVLYWISTFVLILTLLCILGYQLILLVDLEFDYINPYDSTSQINQVVLPEFIIHGIFCFTNLIAGHWFIFLISLPFLYYNLRLYIKREHLADVTEIYNKLNWEKKKRLFKVAYLVLVFAFCIVSLVWTLTEDVH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain