SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g44650

Feature Type:gene_model
Chromosome:Gm18
Start:54390256
stop:54391248
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g44650
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G07730AT Annotation by Michelle Graham. TAIR10: Disease resistance-responsive (dirigent-like protein) family protein | chr1:2397527-2398696 REVERSE LENGTH=389 SoyBaseE_val: 2.00E-24ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF03018PFAM Dirigent-like protein JGI ISS
UniRef100_B6TVE6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Dirigent-like protein n=1 Tax=Zea mays RepID=B6TVE6_MAIZE SoyBaseE_val: 1.00E-25ISS
UniRef100_I1N391UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N391_SOYBN SoyBaseE_val: 2.00E-172ISS

Expression Patterns of Glyma18g44650
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g44650
ParalogEvidenceComments
Glyma09g41190 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g44650 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g214300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g44650
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g44650
>Glyma18g44650.1   sequence type=CDS   gene model=Glyma18g44650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAACTAATCTCAAAAGAAAGCTATGCAACACAATGGCTAGACTTCCTTCTCTTATGGTAAAATTCATGCTACTTTTGTTCATGACTAAGTTTTCTTCAGCTCGAACTCTTGGCAATCCATCCTCTAACCACAACCATGGCCATCACAGAATAACATTTTTAATGAGGGATATGTTCAATGGTAGCACACAATATTCAGAGAAACCAGCCACTACTAAAGTCACTGGTCAACTACCTTTCCCAAAACCCCTAGGCTTTCTTCCTACTAAAGGAGGGATTCCAATTCCACAATCCACTCCAACAACAATTCCACTCACTTCATCATCCACTCAAACACTTGACCTGTCTAGCATTGGCTTCTCTTTTCCCACTAGAGCAACACTCCAAGAGCTAGAATATGGAGCAGTAACACCAATTGATGAGGAACTACTTCATGATGATGGAGATGAACTACACAAACTTGGAAGGGCACAAGGGGTGTGTGTTGCTAGCTCAGAGGATGGAAGCAGCCATATGGTGGCTATCACAGCAAGCTTTTTCAAGGGTGAGTTTCAGGATGGACTGAGGCTTTTTGGAGTGCACAAGACTGATGTTTTTGAGTCACATGTTGCAGTTATTGGAGGCACCGGAAAGTACTATGGTGCTAATGGATATGCTGCTGTCAAGGTTGTGGACAAAGTAGGATCTAGTGAAAAAGAAGGGAAAGTGACAAGTTCAAAGTTCCTCTTGTTTGATGTGTATCTTAGTTGA
Predicted protein sequences of Glyma18g44650
>Glyma18g44650.1   sequence type=predicted peptide   gene model=Glyma18g44650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQTNLKRKLCNTMARLPSLMVKFMLLLFMTKFSSARTLGNPSSNHNHGHHRITFLMRDMFNGSTQYSEKPATTKVTGQLPFPKPLGFLPTKGGIPIPQSTPTTIPLTSSSTQTLDLSSIGFSFPTRATLQELEYGAVTPIDEELLHDDGDELHKLGRAQGVCVASSEDGSSHMVAITASFFKGEFQDGLRLFGVHKTDVFESHVAVIGGTGKYYGANGYAAVKVVDKVGSSEKEGKVTSSKFLLFDVYLS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo