SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g44161

Feature Type:gene_model
Chromosome:Gm18
Start:53812834
stop:53814272
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g44161
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G01750AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF567) | chr5:290034-290685 FORWARD LENGTH=174 SoyBaseE_val: 2.00E-25ISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006995GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to nitrogen starvation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0030003GO-bp Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis SoyBaseN/AISS
GO:0070838GO-bp Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF04525PFAM Protein of unknown function (DUF567) JGI ISS
UniRef100_F4IGE9UniRef Annotation by Michelle Graham. Most informative UniRef hit: LURP1 protein n=2 Tax=Arabidopsis thaliana RepID=F4IGE9_ARATH SoyBaseE_val: 8.00E-22ISS
UniRef100_I1N353UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N353_SOYBN SoyBaseE_val: 6.00E-61ISS

Expression Patterns of Glyma18g44161
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g44161 not represented in the dataset
Glyma18g44161 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g44161 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g210000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g44161
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g44161
>Glyma18g44161.1   sequence type=CDS   gene model=Glyma18g44161   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATTCCCAGTTATCAGCAGTGACTACTGTGCTCCTTACGCTATCAATCTTCAAATCAATACAAAAACAGGTTTCACGTACGACGCAAACAATGCCTGTCGCTTTTATATCGAAGATAAATTATTCACACTTCACAAGCGACGTGTCTTGTGTGATAATCAAGGAAACCCCATTGTCACTCTATACAAGAAGAGAATGACATTGCATGGGCGATGCCAAGTTTTTAGGGGTTATAAAAGCAAAGATTTCTCTCAATTGCTCTTTTCAGTGAAGAGATCATCAATGATACCGAGTGGGATGGTTAACTTAGAGGTCTTCCTCGCTAACAACCAAAGAGAAAGTGCCTGTGACTTTAGAGTCAACGTTTAA
Predicted protein sequences of Glyma18g44161
>Glyma18g44161.1   sequence type=predicted peptide   gene model=Glyma18g44161   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFPVISSDYCAPYAINLQINTKTGFTYDANNACRFYIEDKLFTLHKRRVLCDNQGNPIVTLYKKRMTLHGRCQVFRGYKSKDFSQLLFSVKRSSMIPSGMVNLEVFLANNQRESACDFRVNV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo