SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g42630

Feature Type:gene_model
Chromosome:Gm18
Start:51879358
stop:51882087
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g42630
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G01620AT Annotation by Michelle Graham. TAIR10: plasma membrane intrinsic protein 1C | chr1:225986-226960 REVERSE LENGTH=214 SoyBaseE_val: 2.00E-136ISS
GO:0006084GO-bp Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010106GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016021GO-cc Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane SoyBaseN/AISS
GO:0005215GO-mf Annotation by Michelle Graham. GO Molecular Function: transporter activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0015250GO-mf Annotation by Michelle Graham. GO Molecular Function: water channel activity SoyBaseN/AISS
KOG0223 KOG Aquaporin (major intrinsic protein family) JGI ISS
PTHR19139Panther AQUAPORIN TRANSPORTER JGI ISS
PTHR19139:SF55Panther SUBFAMILY NOT NAMED JGI ISS
PF00230PFAM Major intrinsic protein JGI ISS
UniRef100_D8FSJ9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Aquaporin PIP1;6 n=1 Tax=Gossypium hirsutum RepID=D8FSJ9_GOSHI SoyBaseE_val: 4.00E-141ISS
UniRef100_I1N2V3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1N2V3_SOYBN SoyBaseE_val: 1.00E-151ISS

Expression Patterns of Glyma18g42630
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g42630 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g198300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g42630
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g42630
>Glyma18g42630.2   sequence type=CDS   gene model=Glyma18g42630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGTTGCAAAATCTCCCAGCAAGTGCTCCACTGTTGGTGTCCAAGGCATTGCTTGGTCATTTGGTGGAATGATCTTTGCCCTTGTCTATTGTACTGCTGGTATCTCAGGGGGTCACATTAACCCAGCTGTGACATTTGGGCTGTTTTTGGCACGCAAGTTATCTCTCACTAGGACAGTGTTCTACATGATCATGCAGTGCTTGGGAGCTATATGTGGTGCTGCTGTGGTCAAGGGATTCCAATCAAACCAATATGAGAGGCTTGGTGGTGGTGCCAACACTCTCAGTAAAGGATACTCCAAAGGTGATGGCCTTGGAGCAGAGATTGTTGGCACATTTATTCTTGTTTACACTGTTTTCTCTGCCACAGATGCCAAACGAAATGCTAGAGACTCGCATGTTCCTATTTTGGCACCATTGCCTATCGGTTTTGCGGTCTTTCTGGTGCATTTAGCTACAATTCCTATCACTGGGACTGGCATCAACCCTGCTAGAAGTTTAGGTGCAGCCCTTGTATACAACAAGGACCAAGCTTGGGATAACCATTGGATCTTCTGGGTAGGGCCTTTTATTGGGGCAGCACTTGCAGCTTTATACCATCAGATAGTGCTCAGGGCCATTCCTTTCAAGTCAAAATAA
Predicted protein sequences of Glyma18g42630
>Glyma18g42630.2   sequence type=predicted peptide   gene model=Glyma18g42630   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVAKSPSKCSTVGVQGIAWSFGGMIFALVYCTAGISGGHINPAVTFGLFLARKLSLTRTVFYMIMQCLGAICGAAVVKGFQSNQYERLGGGANTLSKGYSKGDGLGAEIVGTFILVYTVFSATDAKRNARDSHVPILAPLPIGFAVFLVHLATIPITGTGINPARSLGAALVYNKDQAWDNHWIFWVGPFIGAALAALYHQIVLRAIPFKSK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo