|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G01620 | AT | Annotation by Michelle Graham. TAIR10: plasma membrane intrinsic protein 1C | chr1:225986-226960 REVERSE LENGTH=214 | SoyBase | E_val: 2.00E-136 | ISS |
| GO:0006084 | GO-bp | Annotation by Michelle Graham. GO Biological Process: acetyl-CoA metabolic process | SoyBase | N/A | ISS |
| GO:0006810 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transport | SoyBase | N/A | ISS |
| GO:0006826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: iron ion transport | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0009414 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to water deprivation | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0010106 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation | SoyBase | N/A | ISS |
| GO:0016126 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process | SoyBase | N/A | ISS |
| GO:0016132 | GO-bp | Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0005215 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: transporter activity | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0015250 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: water channel activity | SoyBase | N/A | ISS |
| KOG0223 | KOG | Aquaporin (major intrinsic protein family) | JGI | ISS | |
| PTHR19139 | Panther | AQUAPORIN TRANSPORTER | JGI | ISS | |
| PTHR19139:SF55 | Panther | SUBFAMILY NOT NAMED | JGI | ISS | |
| PF00230 | PFAM | Major intrinsic protein | JGI | ISS | |
| UniRef100_D8FSJ9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Aquaporin PIP1;6 n=1 Tax=Gossypium hirsutum RepID=D8FSJ9_GOSHI | SoyBase | E_val: 4.00E-141 | ISS |
| UniRef100_I1N2V3 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1N2V3_SOYBN | SoyBase | E_val: 1.00E-151 | ISS |
|
Glyma18g42630 not represented in the dataset |
Glyma18g42630 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.18g198300 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma18g42630.2 sequence type=CDS gene model=Glyma18g42630 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGGTGTTGCAAAATCTCCCAGCAAGTGCTCCACTGTTGGTGTCCAAGGCATTGCTTGGTCATTTGGTGGAATGATCTTTGCCCTTGTCTATTGTACTGCTGGTATCTCAGGGGGTCACATTAACCCAGCTGTGACATTTGGGCTGTTTTTGGCACGCAAGTTATCTCTCACTAGGACAGTGTTCTACATGATCATGCAGTGCTTGGGAGCTATATGTGGTGCTGCTGTGGTCAAGGGATTCCAATCAAACCAATATGAGAGGCTTGGTGGTGGTGCCAACACTCTCAGTAAAGGATACTCCAAAGGTGATGGCCTTGGAGCAGAGATTGTTGGCACATTTATTCTTGTTTACACTGTTTTCTCTGCCACAGATGCCAAACGAAATGCTAGAGACTCGCATGTTCCTATTTTGGCACCATTGCCTATCGGTTTTGCGGTCTTTCTGGTGCATTTAGCTACAATTCCTATCACTGGGACTGGCATCAACCCTGCTAGAAGTTTAGGTGCAGCCCTTGTATACAACAAGGACCAAGCTTGGGATAACCATTGGATCTTCTGGGTAGGGCCTTTTATTGGGGCAGCACTTGCAGCTTTATACCATCAGATAGTGCTCAGGGCCATTCCTTTCAAGTCAAAATAA
>Glyma18g42630.2 sequence type=predicted peptide gene model=Glyma18g42630 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MGVAKSPSKCSTVGVQGIAWSFGGMIFALVYCTAGISGGHINPAVTFGLFLARKLSLTRTVFYMIMQCLGAICGAAVVKGFQSNQYERLGGGANTLSKGYSKGDGLGAEIVGTFILVYTVFSATDAKRNARDSHVPILAPLPIGFAVFLVHLATIPITGTGINPARSLGAALVYNKDQAWDNHWIFWVGPFIGAALAALYHQIVLRAIPFKSK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||