SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g42590): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g42590): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g42590

Feature Type:gene_model
Chromosome:Gm18
Start:51793703
stop:51796171
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14420AT Annotation by Michelle Graham. TAIR10: Aldolase-type TIM barrel family protein | chr3:4821861-4823899 FORWARD LENGTH=348 SoyBaseE_val: 1.00E-88ISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0050665GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0008891GO-mf Annotation by Michelle Graham. GO Molecular Function: glycolate oxidase activity SoyBaseN/AISS
GO:0010181GO-mf Annotation by Michelle Graham. GO Molecular Function: FMN binding SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
KOG0538 KOG Glycolate oxidase JGI ISS
PTHR10578Panther (S)-2-HYDROXY-ACID OXIDASE-RELATED JGI ISS
PTHR10578:SF9Panther L-LACTATE-2-MONOXYGENASE JGI ISS
PF01070PFAM FMN-dependent dehydrogenase JGI ISS
UniRef100_D7EZN6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycolate oxidase n=1 Tax=Mikania micrantha RepID=D7EZN6_9ASTR SoyBaseE_val: 1.00E-88ISS
UniRef100_I1N2V0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1N2V0_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g42590 not represented in the dataset

Glyma18g42590 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g42590.1   sequence type=CDS   gene model=Glyma18g42590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TATTCAACTCTCCTCTCCTTTAATATATCTCCAAAAATACTTGGAATAAAAATAAAGCTATGCACAAAAGAATCAACTACTGCTAAAGCAACATCAACAGCTAGCACAATTATGACACTATCCTCATGGGCTATTTCCAGTGTTGAGGAGGTTGCTTCAATAGGCCTTGACATTCATTTTTTTCAACTTTATCTTGTGAGAAGAGCTGAAAGAGTTGGTTTCAAGGCAATTGCCTTTACTATGGACATTGATATTCTTGGTCGTGGGGAGGTTGACATCAAAAATAGTGTGTTTTATAAATTTACATTGCCACCAAACTTGGTTTTGAAGAATTTTGAAGGATTGGATCTTGGAAAGCTAGACAAGGTTGACTCTGGTCTTGCCTCTTATGTTGCTGGACAAATTGATCGCAATAACATGTACAACCTTTTAAGGGTGTACTTAGTGCTCAAGATATTGCTTGAATCATTGTTTTCCAATCATGGAGCTCATCAACTTAATTGTGTCCCTGCAACTATTATGGCTTTGGAAGAGTTAAAGTTGCATAAAGGAAAAATTCCAGAATTTTTGCATGGTGGAATTCGTCGAGGGACATATGTTTTTAATGCCCTAGCTCTTGAAGCAGCCGGTGTATTCGTAAATGGTGAGGCTAGTGTGAGAAAAGTACTTCAAATGCTCCGTGATGAATTTGAACTAACAATGGTGCTAAGTGGTTGGCATTCGCTCAAGGTGATAACTCATAACCATGTTGTCATAGAGTGGGATCACCCAAGATTTGCTCTGAAGTTATAA

>Glyma18g42590.1   sequence type=predicted peptide   gene model=Glyma18g42590   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
YSTLLSFNISPKILGIKIKLCTKESTTAKATSTASTIMTLSSWAISSVEEVASIGLDIHFFQLYLVRRAERVGFKAIAFTMDIDILGRGEVDIKNSVFYKFTLPPNLVLKNFEGLDLGKLDKVDSGLASYVAGQIDRNNMYNLLRVYLVLKILLESLFSNHGAHQLNCVPATIMALEELKLHKGKIPEFLHGGIRRGTYVFNALALEAAGVFVNGEASVRKVLQMLRDEFELTMVLSGWHSLKVITHNHVVIEWDHPRFALKL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo