Report for Sequence Feature Glyma18g42590
Feature Type: gene_model
Chromosome: Gm18
Start: 51793703
stop: 51796171
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma18g42590
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G14420 AT
Annotation by Michelle Graham. TAIR10: Aldolase-type TIM barrel family protein | chr3:4821861-4823899 FORWARD LENGTH=348
SoyBase E_val: 1.00E-88 ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0050665 GO-bp
Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide biosynthetic process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005777 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: peroxisome
SoyBase N/A ISS
GO:0009506 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0009570 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0022626 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome
SoyBase N/A ISS
GO:0048046 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: apoplast
SoyBase N/A ISS
GO:0003824 GO-mf
Annotation by Michelle Graham. GO Molecular Function: catalytic activity
SoyBase N/A ISS
GO:0008891 GO-mf
Annotation by Michelle Graham. GO Molecular Function: glycolate oxidase activity
SoyBase N/A ISS
GO:0010181 GO-mf
Annotation by Michelle Graham. GO Molecular Function: FMN binding
SoyBase N/A ISS
GO:0016491 GO-mf
Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity
SoyBase N/A ISS
KOG0538
KOG
Glycolate oxidase
JGI ISS
PTHR10578 Panther
(S)-2-HYDROXY-ACID OXIDASE-RELATED
JGI ISS
PTHR10578:SF9 Panther
L-LACTATE-2-MONOXYGENASE
JGI ISS
PF01070 PFAM
FMN-dependent dehydrogenase
JGI ISS
UniRef100_D7EZN6 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glycolate oxidase n=1 Tax=Mikania micrantha RepID=D7EZN6_9ASTR
SoyBase E_val: 1.00E-88 ISS
UniRef100_I1N2V0 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1N2V0_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma18g42590
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma18g42590 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
References for Glyma18g42590
Coding sequences of Glyma18g42590
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma18g42590.1 sequence type=CDS gene model=Glyma18g42590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
TATTCAACTCTCCTCTCCTTTAATATATCTCCAAAAATACTTGGAATAAAAATAAAGCTATGCACAAAAGAATCAACTACTGCTAAAGCAACATCAACAGCTAGCACAATTATGACACTATCCTCATGGGCTATTTCCAGTGTTGAGGAGGTTGCTTCAATAGGCCTTGACATTCATTTTTTTCAACTTTATCTTGTGAGAAGAGCTGAAAGAGTTGGTTTCAAGGCAATTGCCTTTACTATGGACATTGATATTCTTGGTCGTGGGGAGGTTGACATCAAAAATAGTGTGTTTTATAAATTTACATTGCCACCAAACTTGGTTTTGAAGAATTTTGAAGGATTGGATCTTGGAAAGCTAGACAAGGTTGACTCTGGTCTTGCCTCTTATGTTGCTGGACAAATTGATCGCAATAACATGTACAACCTTTTAAGGGTGTACTTAGTGCTCAAGATATTGCTTGAATCATTGTTTTCCAATCATGGAGCTCATCAACTTAATTGTGTCCCTGCAACTATTATGGCTTTGGAAGAGTTAAAGTTGCATAAAGGAAAAATTCCAGAATTTTTGCATGGTGGAATTCGTCGAGGGACATATGTTTTTAATGCCCTAGCTCTTGAAGCAGCCGGTGTATTCGTAAATGGTGAGGCTAGTGTGAGAAAAGTACTTCAAATGCTCCGTGATGAATTTGAACTAACAATGGTGCTAAGTGGTTGGCATTCGCTCAAGGTGATAACTCATAACCATGTTGTCATAGAGTGGGATCACCCAAGATTTGCTCTGAAGTTATAA
Predicted protein sequences of Glyma18g42590
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma18g42590.1 sequence type=predicted peptide gene model=Glyma18g42590 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
YSTLLSFNISPKILGIKIKLCTKESTTAKATSTASTIMTLSSWAISSVEEVASIGLDIHFFQLYLVRRAERVGFKAIAFTMDIDILGRGEVDIKNSVFYKFTLPPNLVLKNFEGLDLGKLDKVDSGLASYVAGQIDRNNMYNLLRVYLVLKILLESLFSNHGAHQLNCVPATIMALEELKLHKGKIPEFLHGGIRRGTYVFNALALEAAGVFVNGEASVRKVLQMLRDEFELTMVLSGWHSLKVITHNHVVIEWDHPRFALKL*