SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g42051

Feature Type:gene_model
Chromosome:Gm18
Start:51018625
stop:51019414
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g42051
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G13870AT Annotation by Michelle Graham. TAIR10: Werner syndrome-like exonuclease | chr4:8023563-8025542 REVERSE LENGTH=288 SoyBaseE_val: 2.00E-23ISS
GO:0006139GO-bp Annotation by Michelle Graham. GO Biological Process: nucleobase-containing compound metabolic process SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008408GO-mf Annotation by Michelle Graham. GO Molecular Function: 3'-5' exonuclease activity SoyBaseN/AISS
PTHR13620Panther 3-5 EXONUCLEASE JGI ISS
PF01612PFAM 3'-5' exonuclease JGI ISS
UniRef100_B9SNW3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 3-5 exonuclease, putative n=1 Tax=Ricinus communis RepID=B9SNW3_RICCO SoyBaseE_val: 9.00E-58ISS
UniRef100_I1N2S2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N2S2_SOYBN SoyBaseE_val: 3.00E-114ISS

Expression Patterns of Glyma18g42051
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g42051 not represented in the dataset
Glyma18g42051 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g42051
ParalogEvidenceComments
Glyma07g17250 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g42051 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g194300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g42051
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g42051
>Glyma18g42051.1   sequence type=CDS   gene model=Glyma18g42051   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAGAAGAAAATAGCGTGCCGCTTTGGATCCAAAACAGAATGTACCCAGTGGTCACGATGAGCGTGGTGGACCACAACCTCCCCTTCCACACCCACAACTACAACCTCTACGAAGTCACCTTCCAGTGCTGCCACTACGACACAATAATCCACACCCTCCTCACCTCCGACCCCTCCCGAGTCGCCTCTTGGCTCCCCAACAACGACGGCGTCCGCCGCCGCAACAACCTCATGGTGGGCCTGGATGTCGAGTGGCGGCCCAATTATCAGCCCAACACGCAGCCCAACCCCGTCGCCACCCTCCAACTCTGCACCGGTCACCGCTGCCTCATCTTCCAGATCATCCACGCGCCCTCCATCCCAGCCGCTCTCATTTCCTTCCTGGCTAACCCTAACATCACCTTCTTCGGTGTCGGGATCCGCGCCGACGCCGAGAAGCTTCTAGTAGACTACAATCTTCACGTGGCCAATGTCCGTGACCTCCGCCCCTTGGCCGTGGAGAGGCTTTCTCGCGCGTTTTACCCTGACGTGAGCCAGGCCGGGCTGGCGACGTTGGCCCGCCACGTGTTGGGCGTGGCGGTTGAGAAGCCACAGTGGATCACAAGGAGCAGGTGGGATGATCGTCGCCTCACTAAGGAACAGGTTCAGTATGCGACCATCGATGCCTTTCTCTCCTATGAGATTGGACGCCAGTTGAATGATCCTTCAGCGATTATGTAG
Predicted protein sequences of Glyma18g42051
>Glyma18g42051.1   sequence type=predicted peptide   gene model=Glyma18g42051   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVEENSVPLWIQNRMYPVVTMSVVDHNLPFHTHNYNLYEVTFQCCHYDTIIHTLLTSDPSRVASWLPNNDGVRRRNNLMVGLDVEWRPNYQPNTQPNPVATLQLCTGHRCLIFQIIHAPSIPAALISFLANPNITFFGVGIRADAEKLLVDYNLHVANVRDLRPLAVERLSRAFYPDVSQAGLATLARHVLGVAVEKPQWITRSRWDDRRLTKEQVQYATIDAFLSYEIGRQLNDPSAIM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo