SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g41280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g41280): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g41280

Feature Type:gene_model
Chromosome:Gm18
Start:50074968
stop:50081561
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g41280
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G02030AT Annotation by Michelle Graham. TAIR10: POX (plant homeobox) family protein | chr5:395754-398872 FORWARD LENGTH=575 SoyBaseE_val: 3.00E-124ISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0007389GO-bp Annotation by Michelle Graham. GO Biological Process: pattern specification process SoyBaseN/AISS
GO:0009616GO-bp Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0009886GO-bp Annotation by Michelle Graham. GO Biological Process: post-embryonic morphogenesis SoyBaseN/AISS
GO:0009887GO-bp Annotation by Michelle Graham. GO Biological Process: organ morphogenesis SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009944GO-bp Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010051GO-bp Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation SoyBaseN/AISS
GO:0010076GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of floral meristem identity SoyBaseN/AISS
GO:0010077GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of inflorescence meristem identity SoyBaseN/AISS
GO:0010154GO-bp Annotation by Michelle Graham. GO Biological Process: fruit development SoyBaseN/AISS
GO:0010223GO-bp Annotation by Michelle Graham. GO Biological Process: secondary shoot formation SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010267GO-bp Annotation by Michelle Graham. GO Biological Process: production of ta-siRNAs involved in RNA interference SoyBaseN/AISS
GO:0016246GO-bp Annotation by Michelle Graham. GO Biological Process: RNA interference SoyBaseN/AISS
GO:0035196GO-bp Annotation by Michelle Graham. GO Biological Process: production of miRNAs involved in gene silencing by miRNA SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048367GO-bp Annotation by Michelle Graham. GO Biological Process: shoot development SoyBaseN/AISS
GO:0048438GO-bp Annotation by Michelle Graham. GO Biological Process: floral whorl development SoyBaseN/AISS
GO:0048439GO-bp Annotation by Michelle Graham. GO Biological Process: flower morphogenesis SoyBaseN/AISS
GO:0048457GO-bp Annotation by Michelle Graham. GO Biological Process: floral whorl morphogenesis SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0048507GO-bp Annotation by Michelle Graham. GO Biological Process: meristem development SoyBaseN/AISS
GO:0048513GO-bp Annotation by Michelle Graham. GO Biological Process: organ development SoyBaseN/AISS
GO:0048519GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process SoyBaseN/AISS
GO:0048645GO-bp Annotation by Michelle Graham. GO Biological Process: organ formation SoyBaseN/AISS
GO:0080006GO-bp Annotation by Michelle Graham. GO Biological Process: internode patterning SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
KOG0773 KOG Transcription factor MEIS1 and related HOX domain proteins JGI ISS
PTHR11850Panther HOMEOBOX PROTEIN JGI ISS
PTHR11850:SF51Panther PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 1 JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF07526PFAM Associated with HOX JGI ISS
UniRef100_G7L5K2UniRef Annotation by Michelle Graham. Most informative UniRef hit: BEL1-like homeodomain protein n=1 Tax=Medicago truncatula RepID=G7L5K2_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000233E3ECUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E3EC related cluster n=1 Tax=unknown RepID=UPI000233E3EC SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g41280
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g41280 not represented in the dataset
Glyma18g41280 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g41280 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g189700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g41280
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g41280
>Glyma18g41280.1   sequence type=CDS   gene model=Glyma18g41280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAGGAGGGTTTTGAGCACTACCATGTCCCACAACAAAGTAGAAGGAACAAGCTGAGAGTTTTCCCTGAGCACCAACCTTATTGTTTCGTTGAATCTTCCTCCACTTGCCCTACTTTAGCCTCTCTCTACGATCCTTCGCTTATTATTCCTTCTGATTTGTTAGCTTGTGCCACCCAACAAGGTGGTGGTGGTGCTGCTGCTAAGGAACAAGAAGGTTCCAATTTGATGATGGGGTTTGTTAAAGGAGCGGTTGTGAATGGTGATGCAATTCAAGTCATCATCAACAACAACAACCCTTTATACCAGCTTCAGAACCTTAGGGAATATGGTGACACCTACAATGATGGGAGTGAAATGATGGTGTTCAAGCCTGAGCCTTTGTCTTTGTCCTTGTCTTCCCACAGTAACAGCACTCATCATTACCCTCTGGAACTGAATCTTCAGCGATATGGGGCTGTTAATCCGGGTTTGGTTGGAGGTAACAGTGAGGTTTCGAGGAATTCTGTTCCACTTGGACCCTTTACGGGGTATGCTTCGATATTGAAGGGATCGAGGTTCTTGAAACCCGCACAGCAATTATTGGAAGAGTTATGTGATGTTGGGGTTCGTGGAATTTACACCACCGAGAAGATTATTGCTCCTGATGCATCGTTGATGGAACCTCCTCGTGAGGGTTTTAGTGCTAGTGAAGTTGTTGGTGGGGATGATCCACTTGGGGAATATCAAAATTATGGTAGGATGAAGAAGTGTAGACTATTAACCATGCTTGACGAGGTTCACAGGAGGTACAGGCAGTATTATCAACAGATGCATGCAGTGATAACTTCATTTGAGTATGTTGCAGGCCTTGGTAATGTGGCCCCGTACGCAAGTTTGGCTATAAATGCCATGTCGAAACCATTTAGATGCTTGAAGAATGCTATTACTGACCAGCTTCAGTTCATCAACAAGGCTCCTTTTCAGATAAGCAACAGAAAGGATGAATCTCCAAGGTTCCACAGCAGTGATAGGGGCACTCACAGCCAAAGGCCAGGGTTTCTTGAGCACCAGCAACCAGTTTGGCGACCTCAAAGAGGACTCCCTGAGCGAGCTGTGAGTGTTCTCCGAGCCTGGTTGTTTGAACACTTTCTGCACCCTTATCCTACTGATACTGACAAGTTAATGTTGGCTAAACAAACCGGTCTATCTCGCAACCAGGTGTCTAATTGGTTTATTAATGCAAGAGTAAGGCTTTGGAAACCAATGGTGGAGGAAATACATATGCTAGAATCACAACAAGGTCAAAAGAGGTCACATTGGGAAGAAAGAAGTAAGAAAAACCTAAGTGATCATTTACCTTCAGATCACAACTCTGTTGTTACTGAGAATCCATCCACCTCCATGGAGAAGTTTCATGATGCCCCTTATAAACACCCTAGAAATGAACTTGCTAACAAGCAAGTGAGGAGTCAGGAGCAGCTGAATCAGACCAACACAGGCAATCAGCAAGTCATGGGTGTTGGAGTGAGCAATAATGGGGTGTCTCTCACACTTGGTCTTCACCAAAATCATCACGGTATTGGGTTGTTTGAGCCCTTTGGAATGAGTGCAGCTCAACGTTTTGGCGTTGCCCTTCAGCCTGAGGGCTATGTTCTTAGTAGTTTTGAATCACAAAATCGACATTTTGGAAGAGATGTTATTGGAGGAGGGCAATTGTTGCATGATTTTGCATGCTGA
Predicted protein sequences of Glyma18g41280
>Glyma18g41280.1   sequence type=predicted peptide   gene model=Glyma18g41280   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEEGFEHYHVPQQSRRNKLRVFPEHQPYCFVESSSTCPTLASLYDPSLIIPSDLLACATQQGGGGAAAKEQEGSNLMMGFVKGAVVNGDAIQVIINNNNPLYQLQNLREYGDTYNDGSEMMVFKPEPLSLSLSSHSNSTHHYPLELNLQRYGAVNPGLVGGNSEVSRNSVPLGPFTGYASILKGSRFLKPAQQLLEELCDVGVRGIYTTEKIIAPDASLMEPPREGFSASEVVGGDDPLGEYQNYGRMKKCRLLTMLDEVHRRYRQYYQQMHAVITSFEYVAGLGNVAPYASLAINAMSKPFRCLKNAITDQLQFINKAPFQISNRKDESPRFHSSDRGTHSQRPGFLEHQQPVWRPQRGLPERAVSVLRAWLFEHFLHPYPTDTDKLMLAKQTGLSRNQVSNWFINARVRLWKPMVEEIHMLESQQGQKRSHWEERSKKNLSDHLPSDHNSVVTENPSTSMEKFHDAPYKHPRNELANKQVRSQEQLNQTNTGNQQVMGVGVSNNGVSLTLGLHQNHHGIGLFEPFGMSAAQRFGVALQPEGYVLSSFESQNRHFGRDVIGGGQLLHDFAC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo