SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g40130

Feature Type:gene_model
Chromosome:Gm18
Start:48636163
stop:48639770
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g40130
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G46620AT Annotation by Michelle Graham. TAIR10: zinc finger (C3HC4-type RING finger) family protein | chr3:17178837-17180024 REVERSE LENGTH=395 SoyBaseE_val: 8.00E-75ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009612GO-bp Annotation by Michelle Graham. GO Biological Process: response to mechanical stimulus SoyBaseN/AISS
GO:0009693GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene biosynthetic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0051865GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoubiquitination SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG0320 KOG Predicted E3 ubiquitin ligase JGI ISS
PTHR22763Panther RING ZINC FINGER PROTEIN JGI ISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
PF06547PFAM Protein of unknown function (DUF1117) JGI ISS
UniRef100_B9SZY8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Zinc finger protein, putative n=1 Tax=Ricinus communis RepID=B9SZY8_RICCO SoyBaseE_val: 6.00E-92ISS
UniRef100_I1N2J5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N2J5_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g40130
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g40130
ParalogEvidenceComments
Glyma07g16151 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g40130 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g184200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g40130
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g40130
>Glyma18g40130.1   sequence type=CDS   gene model=Glyma18g40130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCATCACTGGGATCTCCGTCTTCATCATTCTGGTGCTACCGCTGCAACCGCATCGTTAGGGTTCCACAAAACGACGCCGTTCTCCTCTGCCCAGATTGCAACTCCGGCTTCCTAGAAGAGCTACAAACCCCTCCCCACTCGCGCCGATCCACGCGCGGCGGCGGCGGGTCCCCCTTCAACCCGGTAATCGTCCTCCGCAACGCGAACGACGTCGTCTCGCCCGAAACGCGGAACTTCGAACTCTACTACAACGACGCCGTTTCAGGTTCCTCCGGCCCAAGCACTCTCCGCCCCTTACCGCAAGGAGTAACCGAGTTTCTTTTGGGCTCGGGCTTCGACAATTTACTCGACCAGCTCGACGGCGCCGCGGGGGGCAGCGCTCCGCCTCCCCCCGCGGCGGCGTCGAAAGCGGCGATTGAGTCGATGCCGGTGGTTAAGATCCTCGCGAGCCACACCTACGCAGAATCCCACTGCGCGGTTTGCATGGAGAATTTTGAGATCAACTGCGACGCACGTGAGATGCCGTGCGGGCACGTGTACCACTCAGAGTGCATCGTGCCGTGGCTCTCGGTGAGAAACTCGTGCCCCGTGTGCCGCCACGAGGTTCCTTCCGATGAAGTTGAAGAAAGTAATAGTAATAGTAACAATAATACTGTGGGGTTGACTATTTGGAGACTTCCTGGGGGGGGATTCGCTGTGGGCAGGTTCATCGGAGGGAGGGAGCTCCCGCTGGTTTACACGGAGATGGACGGAGGGTTTAACGGCGCTAACGGCGCTCCCAGAAGAGTCGCTTGGGATAGCTCTGTTGGGAGGTCTAGGGAGAGCAGAGGGTTCGGTTCTGCTCTGAGGAATGTCTTTTCGTATTTCGGGAGGGTGAGGAGCTCGTTTTCTCGCCGAACGAGAAATTCGCGTGCCAACGGAAGATCTCGCTCTTAA
Predicted protein sequences of Glyma18g40130
>Glyma18g40130.1   sequence type=predicted peptide   gene model=Glyma18g40130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLGSPSSSFWCYRCNRIVRVPQNDAVLLCPDCNSGFLEELQTPPHSRRSTRGGGGSPFNPVIVLRNANDVVSPETRNFELYYNDAVSGSSGPSTLRPLPQGVTEFLLGSGFDNLLDQLDGAAGGSAPPPPAAASKAAIESMPVVKILASHTYAESHCAVCMENFEINCDAREMPCGHVYHSECIVPWLSVRNSCPVCRHEVPSDEVEESNSNSNNNTVGLTIWRLPGGGFAVGRFIGGRELPLVYTEMDGGFNGANGAPRRVAWDSSVGRSRESRGFGSALRNVFSYFGRVRSSFSRRTRNSRANGRSRS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo