Glyma18g39850 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g39850

Feature Type:	gene_model
Chromosome:	Gm18
Start:	48028293
stop:	48033473
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g39850

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G39700	AT	Annotation by Michelle Graham. TAIR10: expansin A4 \| chr2:16544246-16545434 REVERSE LENGTH=257	SoyBase	E_val: 1.00E-158	ISS
GO:0006949	GO-bp	Annotation by Michelle Graham. GO Biological Process: syncytium formation	SoyBase	N/A	ISS
GO:0009664	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization	SoyBase	N/A	ISS
GO:0009826	GO-bp	Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth	SoyBase	N/A	ISS
GO:0009828	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall loosening	SoyBase	N/A	ISS
GO:0009831	GO-bp	Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification involved in multidimensional cell growth	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009505	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
PF01357	PFAM	Pollen allergen	JGI		ISS
PF03330	PFAM	Rare lipoprotein A (RlpA)-like double-psi beta-barrel	JGI		ISS
UniRef100_I1N2H6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N2H6_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q41043	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Orf protein n=1 Tax=Pisum sativum RepID=Q41043_PEA	SoyBase	E_val: 2.00E-175	ISS

Expression Patterns of Glyma18g39850

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g39850

Paralog	Evidence	Comments
Glyma07g15910	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g39850 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g181700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g39850

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g39850

Limit To All Plant Sequences

>Glyma18g39850.1   sequence type=CDS   gene model=Glyma18g39850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCTATTGTTTTCCTCCACATTGCATCATTGGCCTCTCTTTTTGTTGCAACAAGTGCAAGAATCCCTGGAGTTTACACCGGTGGCCCCTGGCAGAGTGCTCATGCCACCTTCTACGGTGGCAGTGATGCCTCTGGAACAATGGGTGGTGCTTGTGGGTACGGAAACCTGTACAGCCAAGGCTACGGAGTGAACACTGCGGCGCTGAGCACTGCCCTGTTCAACAACGGGCTGAGCTGCGGCGCGTGCTTCGAGATAAAGTGCGACCAGGATCCGCGGTGGTGCAACCCCGGGAGCCCATCGATCCTAATCACTGCGACCAACTTCTGCCCTCCGAACTTCGCCCTTCCGAACGACAATGGCGGATGGTGCAACCCTCCCCGCCCGCACTTCGACCTCGCCATGCCCATGTTCCTCAAGATCGCCCAGTACCGCGCCGGAATCGTCCCCGTCGCTTACCGCCGGGTGCCATGCAGAAAGACAGGGGGCATCAGATTCACAATCAACGGTTTCCGTTACTTCAACCTGGTGCTGATCACCAACGTCGCGGGTGCAGGGGATATCGTGCGCGTGAGCATGAAAGGAAGCAAAACCGCGTGGATGAGCATGAGCCGCAACTGGGGGCAAAACTGGCAATCCAACGCGGTTTTGGTGGGTCAGGCCCTCTCCTTTAGGGTTACCGGCAGTGACCAGCGCACGTCAACCTCCTGGAACGTGGCACCACCTAATTGGCAGTTCGGACAAACCTTCACAGGAAAGAATTTCCGTGTCTAA

Predicted protein sequences of Glyma18g39850

Limit To All Plant Sequences

>Glyma18g39850.1   sequence type=predicted peptide   gene model=Glyma18g39850   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAAIVFLHIASLASLFVATSARIPGVYTGGPWQSAHATFYGGSDASGTMGGACGYGNLYSQGYGVNTAALSTALFNNGLSCGACFEIKCDQDPRWCNPGSPSILITATNFCPPNFALPNDNGGWCNPPRPHFDLAMPMFLKIAQYRAGIVPVAYRRVPCRKTGGIRFTINGFRYFNLVLITNVAGAGDIVRVSMKGSKTAWMSMSRNWGQNWQSNAVLVGQALSFRVTGSDQRTSTSWNVAPPNWQFGQTFTGKNFRV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain