Report for Sequence Feature Glyma18g38560
Feature Type: gene_model
Chromosome: Gm18
Start: 46153747
stop: 46155733
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma18g38560
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G37590 AT
Annotation by Michelle Graham. TAIR10: DNA binding with one finger 2.4 | chr2:15769292-15770497 FORWARD LENGTH=330
SoyBase E_val: 2.00E-58 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0010089 GO-bp
Annotation by Michelle Graham. GO Biological Process: xylem development
SoyBase N/A ISS
GO:0044036 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule metabolic process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0008270 GO-mf
Annotation by Michelle Graham. GO Molecular Function: zinc ion binding
SoyBase N/A ISS
PF02701 PFAM
Dof domain, zinc finger
JGI ISS
UniRef100_G7JUJ4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Dof zinc finger protein n=1 Tax=Medicago truncatula RepID=G7JUJ4_MEDTR
SoyBase E_val: 5.00E-89 ISS
UniRef100_I1N2E0 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N2E0_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma18g38560
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma18g38560
Paralog Evidence Comments
Glyma08g47290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma18g38560 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.18g176300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma18g38560
Coding sequences of Glyma18g38560
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma18g38560.1 sequence type=CDS gene model=Glyma18g38560 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGTTTATACTTCTATCCCATCATATATTGATCCAGCCAACTGGCAGCAACAGCAACCAAATCACCAGCAGCAAGGCAACAACACTGCTGCCAGCTCCCACCTTATTCTGCCACCACCAATACAACCGCCGCCGCCTCCGCCATCGCAACCTCATGGACTCAGCGGTAGCACTACCGCCGGGTCCATCAGGCCCGGTTCGATGGCAGATAGAGCGAGGATGGCCAACATACAGGAAGCTCCACAAAAGTGTCCAAGATGTGAATCCACCAACACGAAGTTTTGCTACTTCAACAACTACAGCCTCTCTCAGCCCCGTCACTTCTGCAAGGCCTGCAGAAGGTACTGGACACGTGGCGGGACCTTGAGGAATGTCCCCGTAGGCGGCGGCTGCCGGAGGAACAAGAGGAGCAGAGGAAGCTCCAGCAGCAACACCAGGTCGCCGGCAAACTCCGATCGCCAAACCGCGAGTGCCGGCTCCGCTTCAACCACCAGTGGCTCCTCTTCTGCTGACTTGGTGGCCAGCCTCGGTGGCGGCACCGGGGTGCCACCGTCTCTTAGGTTCATGGCTCCATTGCATCAACTTGGGGACCACCACCACCTTGGTGGTGGTGGAGGAGAAATAGGGTTAAGCTATGGCTTGAACTATGGCGCAATTTCTGGTCCAATGGGAGGAATAGGAGACTTGAATTTCCATATAGGAGGCACTTTGAGTGGGGGTGGTTCTATGTTATCTGGTTTGGACCAATGGAGGGTTCCACAAACTCACCAATTTCCCTTCTTGTCTGGTTTGGAAGCTACTTCATCACATGGGTTGTACCCTTTTGAAGGTGCTAGTGGCAGTGATGGCTATGGTGGCACTCCCATTAAGGTTTCAACTTCTGGCATTATTTCTCAGCTTGCTTCTGTGAAAATGGAAGACAATCGTCATCATCATCATCAGGAACTTGGTTTGCCTAGACAGTTCTTGGGGGTCAATAATAACCCTAACACAAATGAGCAATATTGGAGTGGTGGTGGTGGTGCCACTTCTACTTGGACTGATCTTTCTGCTTTCAGTTCTTCTTCCACTACTAGTAATAACGCACTATAG
Predicted protein sequences of Glyma18g38560
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma18g38560.1 sequence type=predicted peptide gene model=Glyma18g38560 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MVYTSIPSYIDPANWQQQQPNHQQQGNNTAASSHLILPPPIQPPPPPPSQPHGLSGSTTAGSIRPGSMADRARMANIQEAPQKCPRCESTNTKFCYFNNYSLSQPRHFCKACRRYWTRGGTLRNVPVGGGCRRNKRSRGSSSSNTRSPANSDRQTASAGSASTTSGSSSADLVASLGGGTGVPPSLRFMAPLHQLGDHHHLGGGGGEIGLSYGLNYGAISGPMGGIGDLNFHIGGTLSGGGSMLSGLDQWRVPQTHQFPFLSGLEATSSHGLYPFEGASGSDGYGGTPIKVSTSGIISQLASVKMEDNRHHHHQELGLPRQFLGVNNNPNTNEQYWSGGGGATSTWTDLSAFSSSSTTSNNAL*