SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g35851

Feature Type:gene_model
Chromosome:Gm18
Start:42124059
stop:42128581
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g35851
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G26690AT Annotation by Michelle Graham. TAIR10: PLC-like phosphodiesterase family protein | chr4:13456793-13459890 REVERSE LENGTH=759 SoyBaseE_val: 3.00E-88ISS
GO:0006071GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol metabolic process SoyBaseN/AISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010026GO-bp Annotation by Michelle Graham. GO Biological Process: trichome differentiation SoyBaseN/AISS
GO:0010053GO-bp Annotation by Michelle Graham. GO Biological Process: root epidermal cell differentiation SoyBaseN/AISS
GO:0010442GO-bp Annotation by Michelle Graham. GO Biological Process: guard cell morphogenesis SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0016051GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate biosynthetic process SoyBaseN/AISS
GO:0016126GO-bp Annotation by Michelle Graham. GO Biological Process: sterol biosynthetic process SoyBaseN/AISS
GO:0030243GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose metabolic process SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0052541GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall cellulose metabolic process SoyBaseN/AISS
GO:0052546GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall pectin metabolic process SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0031225GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to membrane SoyBaseN/AISS
GO:0046658GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anchored to plasma membrane SoyBaseN/AISS
GO:0008081GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoric diester hydrolase activity SoyBaseN/AISS
GO:0008889GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerophosphodiester phosphodiesterase activity SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
UniRef100_G7K4B9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycerophosphodiesterase-like protein n=1 Tax=Medicago truncatula RepID=G7K4B9_MEDTR SoyBaseE_val: 4.00E-133ISS
UniRef100_I1JJF7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JJF7_SOYBN SoyBaseE_val: 3.00E-180ISS

Expression Patterns of Glyma18g35851
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g35851 not represented in the dataset
Glyma18g35851 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g35851 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma18g35851
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g35851
>Glyma18g35851.1   sequence type=CDS   gene model=Glyma18g35851   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TCAATATTGAATCCTTTTGCAAAATGCAGATTGTTCAGGAATCTGCCTAAGAATGCTGGGGCATTGTTGACGTTATCATATTTCTTGTCCTTGACAAAAAACCAGACTTCTCTATCAGATGTTGCTATCATTGTTGAGAATGCAACCTATCTTGTAGACAAGCAAGGATTAAGTGTGATTGATGTTGTCATCAGTGCTTTGAGCAAAGCAGGTTATGATAAACCAGGATCCCAAAAGGTATATATTCAATCCACTAATAGTTCTGTACTGCTAAAGTTCAAGGAGAAAACCAGTTATGAGCTTGTGTACAAGATTGACGAGACTGTTGGTGATGCCGCTAATGCAACTGTTGAGGATATAAAGAGCTTTGCTAGTTCTGTGGTTGTCAACAAGGACTCCGTAATTCCTAATAATAATCAATTCCTAACGACCTATACAAATATTGTGCCAAAGCTAAAAATTGCTAACCTCTTAGTTTTTGTAGAAACATTTAGCAGTGAGTTTGTGTCTCCGGCATGGGATTTCTTCGCAGATGCAACTGTTGAGATCAACACATATATTGAGGGAGCACAAATTGATGGTATCATCACAAACTTCCCTAAAATTGTTGATAGATACAGAAGGAACAAATGCTTAGGTTTGGGTGACAACAAACCTACTTACATGGAACCTGTTCAATCAGGTGGTATTTTTGGACTCATTACCAAAGAATTATTTCCTCCAGTCGAGGCTACGTTTCCACCCTTAATAGAATCTAAAGTGGCAGAGCCACCTTTGCCTCCTGTTGCTAAAATAGCCCCAACTTCCAGCCCGAATGCTGGAACCAAATCACCACAGGGAAATTCACAGCCTAAGGTCATTGTCTGCTTCTTCTTGTCCACTCTGGCCGTGTTTATAGCTTCTCTTCTACTTTGA
Predicted protein sequences of Glyma18g35851
>Glyma18g35851.1   sequence type=predicted peptide   gene model=Glyma18g35851   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
SILNPFAKCRLFRNLPKNAGALLTLSYFLSLTKNQTSLSDVAIIVENATYLVDKQGLSVIDVVISALSKAGYDKPGSQKVYIQSTNSSVLLKFKEKTSYELVYKIDETVGDAANATVEDIKSFASSVVVNKDSVIPNNNQFLTTYTNIVPKLKIANLLVFVETFSSEFVSPAWDFFADATVEINTYIEGAQIDGIITNFPKIVDRYRRNKCLGLGDNKPTYMEPVQSGGIFGLITKELFPPVEATFPPLIESKVAEPPLPPVAKIAPTSSPNAGTKSPQGNSQPKVIVCFFLSTLAVFIASLLL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo