Glyma18g32780 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g32780

Feature Type:	gene_model
Chromosome:	Gm18
Start:	38226961
stop:	38228272
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g32780

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G16290	AT	Annotation by Michelle Graham. TAIR10: AAA-type ATPase family protein \| chr3:5521187-5524995 REVERSE LENGTH=876	SoyBase	E_val: 1.00E-14	ISS
GO:0000023	GO-bp	Annotation by Michelle Graham. GO Biological Process: maltose metabolic process	SoyBase	N/A	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0010304	GO-bp	Annotation by Michelle Graham. GO Biological Process: PSII associated light-harvesting complex II catabolic process	SoyBase	N/A	ISS
GO:0019252	GO-bp	Annotation by Michelle Graham. GO Biological Process: starch biosynthetic process	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009941	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope	SoyBase	N/A	ISS
GO:0000166	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotide binding	SoyBase	N/A	ISS
GO:0004176	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP-dependent peptidase activity	SoyBase	N/A	ISS
GO:0004222	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metalloendopeptidase activity	SoyBase	N/A	ISS
GO:0004252	GO-mf	Annotation by Michelle Graham. GO Molecular Function: serine-type endopeptidase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0008237	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metallopeptidase activity	SoyBase	N/A	ISS
GO:0016887	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATPase activity	SoyBase	N/A	ISS
GO:0017111	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleoside-triphosphatase activity	SoyBase	N/A	ISS
PTHR23076	Panther	METALLOPROTEASE M41 FTSH	JGI		ISS
PTHR23076:SF3	Panther	FTSH HOMOLOG	JGI		ISS
UniRef100_B9RQG8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Cell division protein ftsH, putative n=1 Tax=Ricinus communis RepID=B9RQG8_RICCO	SoyBase	E_val: 4.00E-12	ISS
UniRef100_I1M5H4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M5H4_SOYBN	SoyBase	E_val: 5.00E-13	ISS

Expression Patterns of Glyma18g32780

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g32780 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma18g32780

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g32780

Limit To All Plant Sequences

>Glyma18g32780.1   sequence type=CDS   gene model=Glyma18g32780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AATCCTCTTATCATAAAAAATATAAATAAAAGTCAGATCCATAACCACAATGGTCTAGATAGGACAAAAGAAGGTTTAGGTTTAAGAAAGAAAACAAAGAATAGAAGGGTGATGAACCAGAAGCAGCAAGTGCAAATTAATGAGTTATTTAGAAGAAAGAACACTCACTGGAAGCAAAGAAGAGCAGAGTCAAAAGACGTTGTCTCGCTATCTATAGTCATCAATGCCCCACATGACCGGACATCGGAACCTGCCGTGTCGCTGTTAGATTTGACGCCCAGTCACCCCCAAACCCTCAAAGCATCAATCTTTAACACATCAAAGCCACCCAACACGGATTTCCAACATTCCACGAACAAGATCAAAAACCCCAACGTCATGGATTACATGGCTGTTGCAAGTATGACTGATGGAATGGTTGGTGCAGAGCTAGCCAACATAATTGAGGTTGCTGCCATTAATATGATGCGTGATTCAAGGACTGAGGTAATAGCATATACAATATTGCCAGATAGTTATTGTTCAGCAACCTATGGGTTTAATATATACGCAAGAGAAGACGCACAATGGATGCTGATGGGAACTGCAAAG

Predicted protein sequences of Glyma18g32780

Limit To All Plant Sequences

>Glyma18g32780.1   sequence type=predicted peptide   gene model=Glyma18g32780   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
NPLIIKNINKSQIHNHNGLDRTKEGLGLRKKTKNRRVMNQKQQVQINELFRRKNTHWKQRRAESKDVVSLSIVINAPHDRTSEPAVSLLDLTPSHPQTLKASIFNTSKPPNTDFQHSTNKIKNPNVMDYMAVASMTDGMVGAELANIIEVAAINMMRDSRTEVIAYTILPDSYCSATYGFNIYAREDAQWMLMGTAK

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain