SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g32760

Feature Type:gene_model
Chromosome:Gm18
Start:38183917
stop:38185564
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G23240AT Annotation by Michelle Graham. TAIR10: Plant EC metallothionein-like protein, family 15 | chr2:9895995-9896325 REVERSE LENGTH=85 SoyBaseE_val: 1.00E-17ISS
GO:0006829GO-bp Annotation by Michelle Graham. GO Biological Process: zinc ion transport SoyBaseN/AISS
GO:0016114GO-bp Annotation by Michelle Graham. GO Biological Process: terpenoid biosynthetic process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PF02068PFAM Plant PEC family metallothionein JGI ISS
UniRef100_I1N1Y7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N1Y7_SOYBN SoyBaseE_val: 5.00E-51ISS
UniRef100_O23958UniRef Annotation by Michelle Graham. Most informative UniRef hit: Metallothionein-II protein n=1 Tax=Glycine max RepID=O23958_SOYBN SoyBaseE_val: 7.00E-46ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g46080 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g157800 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g32760.1   sequence type=CDS   gene model=Glyma18g32760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGATACAGGTGGAGGAGATGCAGTGAGACCAGTGGTAATATGTGATAACAAGTGTGGCTGCACACTTCCATGCACTGGTGGTTCCACTTGCAGGTGCACAAGTGCTGGCACTGCCACAGGAGGGGGTGCCACAGGAGGGGGTGATCACGTGACATGCTCGTGCGGAGAGCACTGTGGTTGCAATCCATGCTCATGTCCCAAGATTGCGGCTGCTGGAAGTGGTTGCAGATGTGGCACAGATTGTGCATGTGCCTCCTGCCGCACTTAG

>Glyma18g32760.1   sequence type=predicted peptide   gene model=Glyma18g32760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADTGGGDAVRPVVICDNKCGCTLPCTGGSTCRCTSAGTATGGGATGGGDHVTCSCGEHCGCNPCSCPKIAAAGSGCRCGTDCACASCRT*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo