Glyma18g32760 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g32760

Feature Type:	gene_model
Chromosome:	Gm18
Start:	38183917
stop:	38185564
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g32760

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G23240	AT	Annotation by Michelle Graham. TAIR10: Plant EC metallothionein-like protein, family 15 \| chr2:9895995-9896325 REVERSE LENGTH=85	SoyBase	E_val: 1.00E-17	ISS
GO:0006829	GO-bp	Annotation by Michelle Graham. GO Biological Process: zinc ion transport	SoyBase	N/A	ISS
GO:0016114	GO-bp	Annotation by Michelle Graham. GO Biological Process: terpenoid biosynthetic process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PF02068	PFAM	Plant PEC family metallothionein	JGI		ISS
UniRef100_I1N1Y7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N1Y7_SOYBN	SoyBase	E_val: 5.00E-51	ISS
UniRef100_O23958	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Metallothionein-II protein n=1 Tax=Glycine max RepID=O23958_SOYBN	SoyBase	E_val: 7.00E-46	ISS

Expression Patterns of Glyma18g32760

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g32760

Paralog	Evidence	Comments
Glyma08g46080	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g32760 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g157800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g32760

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g32760

Limit To All Plant Sequences

>Glyma18g32760.1   sequence type=CDS   gene model=Glyma18g32760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGATACAGGTGGAGGAGATGCAGTGAGACCAGTGGTAATATGTGATAACAAGTGTGGCTGCACACTTCCATGCACTGGTGGTTCCACTTGCAGGTGCACAAGTGCTGGCACTGCCACAGGAGGGGGTGCCACAGGAGGGGGTGATCACGTGACATGCTCGTGCGGAGAGCACTGTGGTTGCAATCCATGCTCATGTCCCAAGATTGCGGCTGCTGGAAGTGGTTGCAGATGTGGCACAGATTGTGCATGTGCCTCCTGCCGCACTTAG

Predicted protein sequences of Glyma18g32760

Limit To All Plant Sequences

>Glyma18g32760.1   sequence type=predicted peptide   gene model=Glyma18g32760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MADTGGGDAVRPVVICDNKCGCTLPCTGGSTCRCTSAGTATGGGATGGGDHVTCSCGEHCGCNPCSCPKIAAAGSGCRCGTDCACASCRT*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain