Report for Sequence Feature Glyma18g29620
Feature Type: gene_model
Chromosome: Gm18
Start: 34265549
stop: 34266906
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma18g29620
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G01710 AT
Annotation by Michelle Graham. TAIR10: Chaperone DnaJ-domain superfamily protein | chr2:315836-316771 FORWARD LENGTH=311
SoyBase E_val: 3.00E-40 ISS
GO:0006457 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein folding
SoyBase N/A ISS
GO:0005575 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cellular component
SoyBase N/A ISS
GO:0031072 GO-mf
Annotation by Michelle Graham. GO Molecular Function: heat shock protein binding
SoyBase N/A ISS
GO:0051082 GO-mf
Annotation by Michelle Graham. GO Molecular Function: unfolded protein binding
SoyBase N/A ISS
PF00226 PFAM
DnaJ domain
JGI ISS
UniRef100_G7J540 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Chaperone protein dnaJ n=1 Tax=Medicago truncatula RepID=G7J540_MEDTR
SoyBase E_val: 4.00E-42 ISS
UniRef100_I1N1V9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N1V9_SOYBN
SoyBase E_val: 2.00E-156 ISS
Expression Patterns of Glyma18g29620
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma18g29620
Paralog Evidence Comments
Glyma08g38320 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma18g29620 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.18g146200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma18g29620
Coding sequences of Glyma18g29620
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma18g29620.2 sequence type=CDS gene model=Glyma18g29620 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAAACAAGACACAGACAACAACGGAACCCTCGGCGGGTCCGAAGATTCCCTCCTCCGTTCATGTCTCTCTCTTCTCACGCGCCGCAGCTTCACCGCTTGCCGCGAGTCCGCAAACCAAATCTCAAGATCCGACCCGACCGTCTCCCTCCATCTGGACCAAATCCTCGCGGTGGCGGACGTCCTCACCGCGGCGGAGAGCCGCCGAGGACCCTCCCACCCGCACGACTGGTACTCCGTCCTCCGCCTCCACCCCGGCGGCGCCGACAACCGCGACCTAGCACGACAGCACTTCAAGACCCTCGTGCGGCTCCTCGACCCGAACAAGAACAAGCTCCCCTTCGCCGACGAGGCCCTCATGCGCGTGCGCGAGGCCTGGTGCGTTATCTCCGACCCAACGCGCAAGGCCCGCTTCGACAAAGAGATCGAAGAGTCAGCCAGAACGGCGTCGTTTTGGACAATGTGCCCTTACTGCTGGTACCTGCACGAGTACGAGCGCAAGTACGAGGACTGCACGTTGAGGTGTTCGAATTGCCAGAGGACGTTCCACGGCGCGGCGGTGCCGCCGCCACCGCTGGAGGCGGTGGTGGCGGGAAAGGAGGAGTATTACTGCTACCACATGAGCTTGCCGGTGAGGTATCCGGTTGGCGAACGGTGTCGTTTCGGGGGTGAGGGGAATGGGGCGAGGAAGAGGATGAGGGTTAAGACGGTGGCTAATAGAATGAAAATGAAAAGGTTTGTTGATGCTAATAATGGTGAATCTGATAATGATGGGGTGAGGTAG
Predicted protein sequences of Glyma18g29620
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma18g29620.2 sequence type=predicted peptide gene model=Glyma18g29620 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MKQDTDNNGTLGGSEDSLLRSCLSLLTRRSFTACRESANQISRSDPTVSLHLDQILAVADVLTAAESRRGPSHPHDWYSVLRLHPGGADNRDLARQHFKTLVRLLDPNKNKLPFADEALMRVREAWCVISDPTRKARFDKEIEESARTASFWTMCPYCWYLHEYERKYEDCTLRCSNCQRTFHGAAVPPPPLEAVVAGKEEYYCYHMSLPVRYPVGERCRFGGEGNGARKRMRVKTVANRMKMKRFVDANNGESDNDGVR*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
