SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g29591

Feature Type:gene_model
Chromosome:Gm18
Start:34229693
stop:34230726
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g29591
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G15690AT Annotation by Michelle Graham. TAIR10: Inorganic H pyrophosphatase family protein | chr1:5399115-5402185 FORWARD LENGTH=642 SoyBaseE_val: 2.00E-42ISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009926GO-bp Annotation by Michelle Graham. GO Biological Process: auxin polar transport SoyBaseN/AISS
GO:0010248GO-bp Annotation by Michelle Graham. GO Biological Process: establishment or maintenance of transmembrane electrochemical gradient SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0000325GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005794GO-cc Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009705GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endosome membrane SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004427GO-mf Annotation by Michelle Graham. GO Molecular Function: inorganic diphosphatase activity SoyBaseN/AISS
GO:0009678GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen-translocating pyrophosphatase activity SoyBaseN/AISS
PF03030PFAM Inorganic H+ pyrophosphatase JGI ISS
UniRef100_I1MU27UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MU27_SOYBN SoyBaseE_val: 4.00E-43ISS
UniRef100_P21616UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pyrophosphate-energized vacuolar membrane proton pump n=1 Tax=Vigna radiata var. radiata RepID=AVP_VIGRR SoyBaseE_val: 1.00E-42ISS

Expression Patterns of Glyma18g29591
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g29591 not represented in the dataset
Glyma18g29591 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g29591 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma18g29591
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g29591
>Glyma18g29591.1   sequence type=CDS   gene model=Glyma18g29591   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTCAGAGCGCCGACACAGTTGAAGCCAGGTGTACGGTCCACAGCTCCAAGAGCTACACGAAGCTCAATGCTATCGAAAACGACGATTTCTTCTATCGTTTTGAGTACAATTCCTTCACCGGCGCCTTCAATCCTGATAGAGTTGCTATTTATGGGTTTTCTCCTTGCTGCAAATGGTCTTTTGGTTCTTTACATTGCCATCAACTTGTTCAAGATTTACTATGGTGATGATTGGGGTGGTCTTTTTGAGGCCATCACTGGTTATGGTCTTGGTGGGTCTTCTATGGCTTTGTTTGGAAGAGTAGTTGATGGAGGTATCTATACTAAGGTTGCTGATGTTGGTGTTGATCTTGTCCGAAAGGTTGAAAGAAACATCCCCGAAGATGATCCAAGAAATCTAGCTATAAGAAATATAATCCTGAAACTAGGCCCCCTTATTTGGTTTTTAAACATTCTCTAG
Predicted protein sequences of Glyma18g29591
>Glyma18g29591.1   sequence type=predicted peptide   gene model=Glyma18g29591   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFRAPTQLKPGVRSTAPRATRSSMLSKTTISSIVLSTIPSPAPSILIELLFMGFLLAANGLLVLYIAINLFKIYYGDDWGGLFEAITGYGLGGSSMALFGRVVDGGIYTKVADVGVDLVRKVERNIPEDDPRNLAIRNIILKLGPLIWFLNIL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo