SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g27710

Feature Type:gene_model
Chromosome:Gm18
Start:31737282
stop:31743274
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g27710
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G37930AT Annotation by Michelle Graham. TAIR10: serine transhydroxymethyltransferase 1 | chr4:17831891-17834742 REVERSE LENGTH=517 SoyBaseE_val: 0ISS
GO:0006544GO-bp Annotation by Michelle Graham. GO Biological Process: glycine metabolic process SoyBaseN/AISS
GO:0006563GO-bp Annotation by Michelle Graham. GO Biological Process: L-serine metabolic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009626GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type hypersensitive response SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0019464GO-bp Annotation by Michelle Graham. GO Biological Process: glycine decarboxylation via glycine cleavage system SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005759GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial matrix SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004372GO-mf Annotation by Michelle Graham. GO Molecular Function: glycine hydroxymethyltransferase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
GO:0030170GO-mf Annotation by Michelle Graham. GO Molecular Function: pyridoxal phosphate binding SoyBaseN/AISS
KOG2467 KOG Glycine/serine hydroxymethyltransferase JGI ISS
PTHR11680Panther SERINE HYDROXYMETHYLTRANSFERASE JGI ISS
PF00464PFAM Serine hydroxymethyltransferase JGI ISS
UniRef100_C6ZJZ0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine hydroxymethyltransferase 5 n=1 Tax=Glycine max RepID=C6ZJZ0_SOYBN SoyBaseE_val: 0ISS
UniRef100_C6ZJZ0UniRef Annotation by Michelle Graham. Best UniRef hit: Serine hydroxymethyltransferase 5 n=1 Tax=Glycine max RepID=C6ZJZ0_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g27710
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g27710 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g150000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g27710
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g27710
>Glyma18g27710.2   sequence type=CDS   gene model=Glyma18g27710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGATGGCAATGGCGCTTCGCAGGCTTTCATCTTCAATTGATAAGCCTCTTCGCCCTCTCTTCAATGCGGGTTCCCTCTACTACAAGTCGTCTTTGCCTGATGAAGCTGTTTACGACAAGGAGCGACCCGGAGTTACATGGCCGAAGCAGTTGAATGCTTCACTTGAGGTCGTTGATCCTGAGATTGCTGATATTATTGAGCTTGAGAAAGCTAGGCAATGGAAGGGGCTGGAACTGATACCGTCAGAGAATTTCACTTCTGTGTCTGTGATGCAAGCAGTTGGATCTGTGATGACCAACAAATACAGTGAGGGGTACCCTGGTGCAAGATATTATGGTGGAAATGAGTATATTGACATGGCTGAAACACTATGCCAAAAGCGTGCCCTGGAAGCGTTTAGATTGGATCCCGCTAAATGGGGAGTGAACGTGCAGCCTCTGTCAGGGTCTCCTGCAAATTTCCATGTCTACACTGCATTGCTTAAACCTCATGAAAGAATCATGGCACTTGATCTTCCTCATGGTGGCCATCTTTCTCATGGATATCAGACTGATACCAAAAAGATATCTGCTGTCTCAATATTTTTTGAGACAATGCCATATAGATTGAACGAAAGTACGGGATACATTGACTATGACCAGATGGAGAAATCAGCAACACTCTTCAGGCCAAAATTAATTGTTGCTGGAGCTAGCGCTTATGCACGTCTGTATGATTATGAACGTGTACGCAAGGTTTGTGATAAACAGAAAGCTATATTATTGGCAGATATGGCACACATCAGTGGATTGGTTGCAGCTGGTGTCATCCCATCACCTTTTGATTATGCAGATGTAGTTACTACCACCACTCACAAGTCACTTCGGGGACCACGTGGAGCTATGATATTCTACAGAAAAGGCGTTAAAGAAATTAACAAACAAGGAAAAGAGCTATTGTATGACTATGAGGACAAAATCAACCAAGCTGTTTTCCCTGGACTGCAAGGGGGCCCTCACAACCACACTATTACTGGTTTAGCTGTTGCATTGAAGCAGGCCACAACTCCCGAATATAGAGCATATCAGGAACAAGTTCTCAGCAACAGTTTTAAATTTGCACAGGCTCTAAGTGAGAGGGGCTATGAGCTGGTTTCTGGGGGAACTGAGAATCACCTGGTTTTGGTGAATCTGAAGAATAAGGGTATTGATGGCTCCAGAGTTGAGAAGGTGTTGGAAGCAGTTCATATTGCAGCTAATAAAAACACTGTTCCTGGAGATGTGTCTGCCATGGTTCCTGGTGGCATCAGGATGGGAACCCCTGCTCTTACTTCTAGAGGATTTGTTGAGGAGGATTTTGTTAAGGTAGCAGAGTTCTTTGATGCAGCAGTGAAGTTGGCTGTGAAGATTAAGGGACAGAGCAAAGGAACAAAGCTGAAGGACTTCTTGGCCACAATTCAATCATCTTCTACCTTTCAATCGGAGATAGCAAAGCTCCGCCATGATGTTGAGGACTATGCAAAACAATTTCCAACCATTGGTTTTGAGAAAGCTACCATGAAGTACAAGAATTGA
Predicted protein sequences of Glyma18g27710
>Glyma18g27710.2   sequence type=predicted peptide   gene model=Glyma18g27710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAMAMALRRLSSSIDKPLRPLFNAGSLYYKSSLPDEAVYDKERPGVTWPKQLNASLEVVDPEIADIIELEKARQWKGLELIPSENFTSVSVMQAVGSVMTNKYSEGYPGARYYGGNEYIDMAETLCQKRALEAFRLDPAKWGVNVQPLSGSPANFHVYTALLKPHERIMALDLPHGGHLSHGYQTDTKKISAVSIFFETMPYRLNESTGYIDYDQMEKSATLFRPKLIVAGASAYARLYDYERVRKVCDKQKAILLADMAHISGLVAAGVIPSPFDYADVVTTTTHKSLRGPRGAMIFYRKGVKEINKQGKELLYDYEDKINQAVFPGLQGGPHNHTITGLAVALKQATTPEYRAYQEQVLSNSFKFAQALSERGYELVSGGTENHLVLVNLKNKGIDGSRVEKVLEAVHIAANKNTVPGDVSAMVPGGIRMGTPALTSRGFVEEDFVKVAEFFDAAVKLAVKIKGQSKGTKLKDFLATIQSSSTFQSEIAKLRHDVEDYAKQFPTIGFEKATMKYKN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo