SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g25820

Feature Type:gene_model
Chromosome:Gm18
Start:29611318
stop:29612692
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g25820
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G48480AT Annotation by Michelle Graham. TAIR10: Lactoylglutathione lyase / glyoxalase I family protein | chr5:19644814-19645658 FORWARD LENGTH=166 SoyBaseE_val: 2.00E-31ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_G7KZ23UniRef Annotation by Michelle Graham. Most informative UniRef hit: Early tobacco anther n=1 Tax=Medicago truncatula RepID=G7KZ23_MEDTR SoyBaseE_val: 2.00E-72ISS
UniRef100_I1N1R1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N1R1_SOYBN SoyBaseE_val: 9.00E-111ISS

Expression Patterns of Glyma18g25820
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g25820 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g152900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g25820
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g25820
>Glyma18g25820.1   sequence type=CDS   gene model=Glyma18g25820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAGCAAGATGCTCAGAATGGTGGGTCGGAGAATGCCGCTGCTGCGGTGTCGTTTGTCGCTTTGAAGCCGCAGCTCCTCATCGAAGCTCCCAAAGCGAACGACGCCGTTCTGTTCTACAAGGCCGCGTTTGCCGCTGAGGAGGTTGGCCGTACGCTCAACCCTAAGCGTAAAGCGGAGCACGAGCTTCCTCTCATACTCTCCGCAGAGCTCAAAATCGCTGGCTCTACCATTCTCGTTGCTGACCTCGTTGATGACTCTGCTTCAACAGCGAAGGCCGGAGGAAACCGTGTCGTTTTGTGCTTGGAGACGGAGGACGTTGAAGGGGCGATAGAGAAAGCGGTGAGCGCTGGTGCAGTTGCGGATGGTGAAGTGGCGGAAGGTGAAGACGCGTGCTGCGGTGGGCGCGTGGGGAAGGTTAAGGATCCGTACGGCTTTGTTTGGCTCTTCTGCGCTCCTGGAAAAAAGTGTGCTGATGTGGAGGCTTAA
Predicted protein sequences of Glyma18g25820
>Glyma18g25820.1   sequence type=predicted peptide   gene model=Glyma18g25820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQQDAQNGGSENAAAAVSFVALKPQLLIEAPKANDAVLFYKAAFAAEEVGRTLNPKRKAEHELPLILSAELKIAGSTILVADLVDDSASTAKAGGNRVVLCLETEDVEGAIEKAVSAGAVADGEVAEGEDACCGGRVGKVKDPYGFVWLFCAPGKKCADVEA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo