SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g22960

Feature Type:gene_model
Chromosome:Gm18
Start:26371172
stop:26373671
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g22960
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G48960AT Annotation by Michelle Graham. TAIR10: Adenine nucleotide alpha hydrolases-like superfamily protein | chr1:18112552-18113550 FORWARD LENGTH=219 SoyBaseE_val: 5.00E-69ISS
GO:0002238GO-bp Annotation by Michelle Graham. GO Biological Process: response to molecule of fungal origin SoyBaseN/AISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF00582PFAM Universal stress protein family JGI ISS
UniRef100_D7KDY5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Universal stress protein family protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7KDY5_ARALL SoyBaseE_val: 3.00E-68ISS
UniRef100_UPI000233EDFBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233EDFB related cluster n=1 Tax=unknown RepID=UPI000233EDFB SoyBaseE_val: 2.00E-147ISS

Expression Patterns of Glyma18g22960
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g22960
ParalogEvidenceComments
Glyma06g23310 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g22960 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.04g145600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g22960
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g22960
>Glyma18g22960.1   sequence type=CDS   gene model=Glyma18g22960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGTGAAGAAAATTGTGGTGGTTGTAGAAGATGTGAATGCAGCAAGAACTGCTCTAGAATGGGCTCTTAGAAACATCATTCGCTATGGTGACATAATCACCCTTCTCCATGTCTATAATCACTCCACAAGATCAAGAAGCAGAAGCAAAGCACGTCTTCTACGCCTTAATGGCTTCAAATTAGCCCTTTCCTTTCAAGACATGTGCAACAGCTATCCCAACACAAAGGTTGAAATAATTGTCATAGAAGGGGACCAAGAAGGAACCAAGATTGCTGCCACGGTGCGAGAGATTGGAGCTTCCATGCTTGTGGTTGGACTCCATGATTATAGTTTTCTATACAAATTGGCAATGGCCCATTCCCATAATAGCATAGCCAGCATTTTCAACTGCAGAGTACTTGCAATCAAGCAGTCTCATGCGTCATCAGTGAGGCCCATGATATGTGCACTGTCTGTGCTAGACAGTTCAACCAACATGGATTTTTCTCAAATTGATGTTTCTAGATTACAAGTCCCTCGTAGCCCTCCCCCAAAAATTCCATACCGAATCTGTCCTAACCCATCTGCAATTATTTGGAGATCAAAGAAGTCTAGGGGAGAAGGATCTAGTGATATATAA
Predicted protein sequences of Glyma18g22960
>Glyma18g22960.1   sequence type=predicted peptide   gene model=Glyma18g22960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDVKKIVVVVEDVNAARTALEWALRNIIRYGDIITLLHVYNHSTRSRSRSKARLLRLNGFKLALSFQDMCNSYPNTKVEIIVIEGDQEGTKIAATVREIGASMLVVGLHDYSFLYKLAMAHSHNSIASIFNCRVLAIKQSHASSVRPMICALSVLDSSTNMDFSQIDVSRLQVPRSPPPKIPYRICPNPSAIIWRSKKSRGEGSSDI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo