Glyma18g20962 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g20962

Feature Type:	gene_model
Chromosome:	Gm18
Start:	23680661
stop:	23681725
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g20962

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G24590	AT	Annotation by Michelle Graham. TAIR10: DORNROSCHEN-like \| chr1:8714389-8715309 REVERSE LENGTH=306	SoyBase	E_val: 3.00E-39	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009733	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus	SoyBase	N/A	ISS
GO:0009880	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryonic pattern specification	SoyBase	N/A	ISS
GO:0048825	GO-bp	Annotation by Michelle Graham. GO Biological Process: cotyledon development	SoyBase	N/A	ISS
GO:0051726	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_G7JXS9	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: AP2/ERF domain-containing transcription factor n=1 Tax=Medicago truncatula RepID=G7JXS9_MEDTR	SoyBase	E_val: 2.00E-77	ISS
UniRef100_I1N1L1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N1L1_SOYBN	SoyBase	E_val: 1.00E-142	ISS

Expression Patterns of Glyma18g20962

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g20962 not represented in the dataset	Glyma18g20962 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g20962

Paralog	Evidence	Comments
Glyma08g38800	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g20962 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g144700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g20962

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g20962

Limit To All Plant Sequences

>Glyma18g20962.1   sequence type=CDS   gene model=Glyma18g20962   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGAAGCACTCCGTCGTCTCAACGGAATGGCCCCCACTCAAGTCCCCGACACAACCGTCTCCGACCACCACCCCAAGAAGAGCGCCACCAAGCGCGGGCTGCGCGACAACGCCAGCTCCGGCGGCACCATGCGGTACCGCGGCGTGCGCCGCCGCCCCTGGGGCCGGTACGCCGCCGAGATCCGTGACCCGCAGTCGAAGGAGCGGCGCTGGTTGGGCACCTTCGACACGGCGGAGGAGGCCGCCTGCGCCTACGACTACGCCGCCCGCGCCATGCGCGGCGCCAAGGCCCGCACCAATTTCGTCTACCCCGACGCCGCCGACCCCCACCACCACCTCTTCCAACCCTACAATATCAACCCCAAACACTGCCACGTCACCAGGTGGATCCCCAACCAAAATTTAAGCGCTGACTTCTCCACAAATGGCCACAACAACAACAACCCTTCTTCTTCTTCTTCTTCTCTTAACATGCTTCTCTTTCGTGACTTTCTCAACTCTTCTTCTCACCACTTTCATAACAATAATAATAATAGCAAGTCTTCTAGTTGTTATGTAAACTCTTCATCATCATCTTCTTCTGCCACTAACTGTCTCCAAGGTTGTTGCTTTACCAACGCTAATTTTGGAATGGAAGTTGCTGAAGCTATTGATGAAGAATCGGAGTTTTTCCCGCGAGAGTCTTCGGATTCTGGATTGTTGGAGGAGATTGTCCACAAGTTCTTGCCAAAATCGAAGCCCAAGAATGAAACTTTGTCAGCTCCTGAGATGCTTCCTCAACCGAAATTTGATCACAAGAATGTTTCTGCTGCAAAGGGTTATGCTGATATTAGGACGAGGGTTCCGAAGGTTGAAGCTTTTGGTGTCCCTTATGATTCTTCTCCCGTGCAGCAGCAATTCGAAGCCCTTCATCATGGTTTCAACACCATGCAGGGTGTGGCTATGGAGAGAAACAATCAGTTTGTGATGAACCATGTTGCTGCAGGGTGCTCCAACATGGAAGATTTTCTTCAGTATCCAGAGCTTTTTAATTCTCTTGCAGCCAGGATGCAAAACGCTTAG

Predicted protein sequences of Glyma18g20962

Limit To All Plant Sequences

>Glyma18g20962.1   sequence type=predicted peptide   gene model=Glyma18g20962   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEEALRRLNGMAPTQVPDTTVSDHHPKKSATKRGLRDNASSGGTMRYRGVRRRPWGRYAAEIRDPQSKERRWLGTFDTAEEAACAYDYAARAMRGAKARTNFVYPDAADPHHHLFQPYNINPKHCHVTRWIPNQNLSADFSTNGHNNNNPSSSSSSLNMLLFRDFLNSSSHHFHNNNNNSKSSSCYVNSSSSSSSATNCLQGCCFTNANFGMEVAEAIDEESEFFPRESSDSGLLEEIVHKFLPKSKPKNETLSAPEMLPQPKFDHKNVSAAKGYADIRTRVPKVEAFGVPYDSSPVQQQFEALHHGFNTMQGVAMERNNQFVMNHVAAGCSNMEDFLQYPELFNSLAARMQNA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain