SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g20293

Feature Type:gene_model
Chromosome:Gm18
Start:22145201
stop:22158036
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g20293
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G23380AT Annotation by Michelle Graham. TAIR10: KNOTTED1-like homeobox gene 6 | chr1:8297499-8302492 REVERSE LENGTH=327 SoyBaseE_val: 6.00E-142ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009062GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid catabolic process SoyBaseN/AISS
GO:0009855GO-bp Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry SoyBaseN/AISS
GO:0010014GO-bp Annotation by Michelle Graham. GO Biological Process: meristem initiation SoyBaseN/AISS
GO:0010073GO-bp Annotation by Michelle Graham. GO Biological Process: meristem maintenance SoyBaseN/AISS
GO:0048513GO-bp Annotation by Michelle Graham. GO Biological Process: organ development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
KOG0773 KOG Transcription factor MEIS1 and related HOX domain proteins JGI ISS
PTHR11850Panther HOMEOBOX PROTEIN JGI ISS
PTHR11850:SF49Panther PRE-B-CELL LEUKEMIA TRANSCRIPTION FACTOR 4 JGI ISS
PF00046PFAM Homeobox domain JGI ISS
PF03789PFAM ELK domain JGI ISS
PF03790PFAM KNOX1 domain JGI ISS
PF03791PFAM KNOX2 domain JGI ISS
UniRef100_G7K060UniRef Annotation by Michelle Graham. Most informative UniRef hit: Knotted-1 homeobox protein n=1 Tax=Medicago truncatula RepID=G7K060_MEDTR SoyBaseE_val: 5.00E-162ISS
UniRef100_UPI000233E9B7UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E9B7 related cluster n=1 Tax=unknown RepID=UPI000233E9B7 SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g20293
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g20293 not represented in the dataset
Glyma18g20293 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g20293
ParalogEvidenceComments
Glyma08g39170 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g20293 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g141200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g20293
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g20293
>Glyma18g20293.1   sequence type=CDS   gene model=Glyma18g20293   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGACGAAATATACGGCGTGTCATCCACGGCGGAGTACACGGACAGGGCGCTGATGACGCCGGAGAACATATTTCCGGCGGAGTACCACAGCTTCCTAATGTCCTCCGCCGCCCGGACTCCAATGTTCGGATCCGACGAGTTTCTCTCCGCCGCCATCGCCGTCACCGCCGGCAACGAAACCGAACCCTACCCTAACGTCTCCGTCGCACCAGAAATTCAGCGCCACCACGACGCCTCTTCTCTCATCAAAGCCAAAATCGCCTCTCACCCTCACTACCCTCGTCTCCTCCAAGCCTACATCGAATGTCAGAAGGTTGGAGCGCCTCCAGAACTCACGTGTTTGTTAGAGGAAATCCGACGAGAAAACGACGTTCGCCAGAGGGACGTTGTTGTTTCCACGTGCGTTGGAGCCGATCCCGAACTCGACGAGTTCATGGAAACCTACTGTGACATGCTGGTGAAATACAAATCTGATCTGACGCGGCCTTTTGACGAAGCCACCACCTTCCTCAACAAGATCGAAACTCAGCTTACCGATCTCTGCAGCCGTTCTTCTCTTCCAACTCTTTACGATGATGGGGGTGTGTCTTCAGAAGAAGGTTTTAGTGCTGGAGATGGTGATCCCCAAGATGGCCAATTACGGAGTGAAGATCGAGAGCTGAAGGATAGGCTTTTACGTAGGTTTGGAAGTCACGTTGGATCTTTGAAATTGGAATTTTCAAAGAAGAAAAAGAGGGGTAAGCTGCCGAAAGACGCTAGGCAAACACTACTTCAGTGGTGGAATATTCACTACAAATGGCCTTACCCTACGGAAGGTGATAAGATTGCACTGGCTAAATCAACTGGATTAGACCAGAAGCAAATTAACAACTGGTTTATTAATCAGAGAAAGCGCTACTGGAAACCATCTGAGAACATGCCGTTCTCTATGGTGGATGGTCTGACCGGTCGGTTCCTTACTGATGAATGA
Predicted protein sequences of Glyma18g20293
>Glyma18g20293.1   sequence type=predicted peptide   gene model=Glyma18g20293   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEDEIYGVSSTAEYTDRALMTPENIFPAEYHSFLMSSAARTPMFGSDEFLSAAIAVTAGNETEPYPNVSVAPEIQRHHDASSLIKAKIASHPHYPRLLQAYIECQKVGAPPELTCLLEEIRRENDVRQRDVVVSTCVGADPELDEFMETYCDMLVKYKSDLTRPFDEATTFLNKIETQLTDLCSRSSLPTLYDDGGVSSEEGFSAGDGDPQDGQLRSEDRELKDRLLRRFGSHVGSLKLEFSKKKKRGKLPKDARQTLLQWWNIHYKWPYPTEGDKIALAKSTGLDQKQINNWFINQRKRYWKPSENMPFSMVDGLTGRFLTDE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo