SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g15534

Feature Type:gene_model
Chromosome:Gm18
Start:15606486
stop:15611063
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G69710AT Annotation by Michelle Graham. TAIR10: Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain | chr1:26222325-26226530 FORWARD LENGTH=1041 SoyBaseE_val: 1.00E-54ISS
GO:0005575GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cellular component SoyBaseN/AISS
GO:0003682GO-mf Annotation by Michelle Graham. GO Molecular Function: chromatin binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0008536GO-mf Annotation by Michelle Graham. GO Molecular Function: Ran GTPase binding SoyBaseN/AISS
GO:0046872GO-mf Annotation by Michelle Graham. GO Molecular Function: metal ion binding SoyBaseN/AISS
PTHR22870Panther REGULATOR OF CHROMOSOME CONDENSATION JGI ISS
PF08381PFAM Disease resistance/zinc finger/chromosome condensation-like region JGI ISS
UniRef100_F4I287UniRef Annotation by Michelle Graham. Most informative UniRef hit: Regulator of chromosome condensation and FYVE zinc finger domain-containing protein n=2 Tax=Arabidopsis thaliana RepID=F4I287_ARATH SoyBaseE_val: 5.00E-52ISS
UniRef100_I1N165UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N165_SOYBN SoyBaseE_val: 7.00E-176ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g15534 not represented in the dataset

Glyma18g15534 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g15534.1   sequence type=CDS   gene model=Glyma18g15534   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGGATTTTGCTCCTTCAAAATCATCAAATTCTCTTTCTATGGATTCCAAGAAACACCTTTCAGTTTCTGAGCCCGCTGCAAGAATATCTTGTCAATCAATGTCACCAGTTTCATCAAAGTCAAGTCCAAGACAATCTTATGAAGATATAAATGATGATTTAAAGTACAGAAATGATATTTTAAGTCTAGAAGTTATAAGTTTAAGGACACTGGTTGAAGAGCTTACTCACAAGTCAAAAAGTTTAGAGGCTGAACATGAGAGAACATCAACGCAATTGAAGGAAATGACTGCAGTAGCTGCAGATGAAGCTGGAAAGTGTAAATCAGCAAAAGAGGTCATAAAGCCATTAACTGCACAGTTGAAAGAAATGGTGGAAAGACTGCCAGAAGGACATAATACTGACTCCAGTACAGAGCCCTTTGCTGAAAACACTAGTAGCATTCTACATAATTCCTTAGATGAGAGCCATATAAGAAACACCGTCATTCCCAAAAATGAAGGCAGCAGCATTGTAACAAATCTGATATTAGCTAATGGTACCAAAACACAAAGTGGAAAGGCAGAGTGGGTAGTGCAAGATGAACCAGGTGTGTATGTAAGTTTGTCCTCACAGCCAGGTGGTGGTAATGAGCTTAAGCGTGTCCGCTTCAGTCGAAGGCATTTCACAGAAGAGCAAGCTGAAAAATGGTGGGCTGAAAATGGAACCAAAATATTGGAGCGGCACAATATAGTTGCTTTATTGAATGCAAGAGAATCTGTTCCCTGA

>Glyma18g15534.1   sequence type=predicted peptide   gene model=Glyma18g15534   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRDFAPSKSSNSLSMDSKKHLSVSEPAARISCQSMSPVSSKSSPRQSYEDINDDLKYRNDILSLEVISLRTLVEELTHKSKSLEAEHERTSTQLKEMTAVAADEAGKCKSAKEVIKPLTAQLKEMVERLPEGHNTDSSTEPFAENTSSILHNSLDESHIRNTVIPKNEGSSIVTNLILANGTKTQSGKAEWVVQDEPGVYVSLSSQPGGGNELKRVRFSRRHFTEEQAEKWWAENGTKILERHNIVALLNARESVP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo