Glyma18g15500 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g15500

Feature Type:	gene_model
Chromosome:	Gm18
Start:	15564145
stop:	15565226
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g15500

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G21940	AT	Annotation by Michelle Graham. TAIR10: shikimate kinase 1 \| chr2:9351106-9352881 FORWARD LENGTH=304	SoyBase	E_val: 4.00E-34	ISS
GO:0006744	GO-bp	Annotation by Michelle Graham. GO Biological Process: ubiquinone biosynthetic process	SoyBase	N/A	ISS
GO:0019632	GO-bp	Annotation by Michelle Graham. GO Biological Process: shikimate metabolic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0004765	GO-mf	Annotation by Michelle Graham. GO Molecular Function: shikimate kinase activity	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
UniRef100_I1JY84	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1JY84_SOYBN	SoyBase	E_val: 3.00E-49	ISS
UniRef100_Q6PLR3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Shikimate kinase (Fragment) n=1 Tax=Cucumis sativus RepID=Q6PLR3_CUCSA	SoyBase	E_val: 3.00E-35	ISS

Expression Patterns of Glyma18g15500

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g15500 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma18g15500

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g15500

Limit To All Plant Sequences

>Glyma18g15500.1   sequence type=CDS   gene model=Glyma18g15500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATTAAGGTGTTGCAGATGTTGTCATTAATGCACAAACATGTTATTTCTATCGATGGAGGTGTTGTTCTAATGCCCAACAATTGGAAATATATGCGTAGGGGGATTAGTAGAATAACAATTATAGGAACTGATTCTCGCCCACTCCTACATTCTGAAGCAAGAAATGCATACATGGAGACTATCAAGTGTTTGTCTATCATTTGTGAAGAAAGAAGTGAAGCATATGCAAATGTCAATGTCAAAGTCTCCTTGGAAAATATGGCAGCAAAATTAAGCCAAAGAGACGTGTCAGATTTTTCTCCAACTGCTATTGCTATGGAGGCACCGGAACAAATCAAATGCTTTCTTATAAGTGAAGATGGGTTTTAA

Predicted protein sequences of Glyma18g15500

Limit To All Plant Sequences

>Glyma18g15500.1   sequence type=predicted peptide   gene model=Glyma18g15500   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
IKVLQMLSLMHKHVISIDGGVVLMPNNWKYMRRGISRITIIGTDSRPLLHSEARNAYMETIKCLSIICEERSEAYANVNVKVSLENMAAKLSQRDVSDFSPTAIAMEAPEQIKCFLISEDGF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain