SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g15150

Feature Type:gene_model
Chromosome:Gm18
Start:15170217
stop:15175476
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g15150
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G10940AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr1:3656050-3658170 REVERSE LENGTH=363 SoyBaseE_val: 4.00E-43ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0042752GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of circadian rhythm SoyBaseN/AISS
GO:0080022GO-bp Annotation by Michelle Graham. GO Biological Process: primary root development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0070300GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphatidic acid binding SoyBaseN/AISS
PTHR24343Panther SERINE/THREONINE KINASE JGI ISS
PTHR24343:SF58Panther SUBFAMILY NOT NAMED JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G7LGB9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Serine/threonine protein kinase SAPK3 n=1 Tax=Medicago truncatula RepID=G7LGB9_MEDTR SoyBaseE_val: 4.00E-41ISS
UniRef100_I1N154UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N154_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g15150
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g15150 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma18g15150
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g15150
>Glyma18g15150.1   sequence type=CDS   gene model=Glyma18g15150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGCAGACTCATCGAGCGCGTCAGGGCCAAGAGGAACAACATCGGACGGAGGCAGAAAAATTGAAAAGGATATACAAAGACGGTCATTAGTAAAACCCGTCGTTGTCTTAGTTTCATGTAATTACAATATTGCCACCGAAGAACATTCTAAGACGGTTGTTTACAACCGCCTTAGAATGTGCGACGTTAAATACAAAAAAAATGTAAGAGAAATCATTAATCACAGGTCTTTAAGACATCCTAACATTATCAGGTTTAAAAAGGTTGAATATGCATCTGGTGGAGAACTATTTGAGAAAACCTGCAATTGGGGGCATTTTAATGAGGATGAGGTCCTTATTTCCTGTGTAACTATTAACCCATTGTTATGCCACATGCTCGTTTCTTCCTTCAACAACTCATATTGGGGTCAGCTATTGTCATGCAATGAATATAGTATAGGCAATGTGTCAATCTTGAGTATTATGTATGATGTGATGTATGAGTCTTATGACCTGAAGTTGGAAAACAATTTGTTGGATGGAAGACCAGCACTTCATTTGAAGATATGTGATTTTGGATACTCCAAGTTTGTGCTTGATCCATTCATTAAAATTGGGTTTATCCCAAGTCTAAGTAATAGAGTGCTAGACCAGAATGTAGGCTTGAATTCTGAAATGCTCAGGATTTGGAAAGTGTATGTTTGTAAGAAGAGGATTAGGAGAATGATAAATGTCTGGTCATGTGGAGTAACCTTATTTGTGATGCTAATGGGATCATATCCTTTTGAAGATCCTAATGATCCAAAGGATTTCCAGAAGACAATTCAACATCTGGTTGCAGGGTTCTCAATGTCATATAAATCAGATTGTGCATGTAGGCAATTAATAAAAAGGCATTGTAAGACAATTCTCCAAAAAATTATCTTAGAAAGTCTACTTTCTAAGATGGTTTTAGAGAAAACCGTCTTAGAATCCACAATTTTTTTAAAAAAAGATATTATAAAACAGTTTTTTAGAAAGCTATTTTAA
Predicted protein sequences of Glyma18g15150
>Glyma18g15150.1   sequence type=predicted peptide   gene model=Glyma18g15150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEADSSSASGPRGTTSDGGRKIEKDIQRRSLVKPVVVLVSCNYNIATEEHSKTVVYNRLRMCDVKYKKNVREIINHRSLRHPNIIRFKKVEYASGGELFEKTCNWGHFNEDEVLISCVTINPLLCHMLVSSFNNSYWGQLLSCNEYSIGNVSILSIMYDVMYESYDLKLENNLLDGRPALHLKICDFGYSKFVLDPFIKIGFIPSLSNRVLDQNVGLNSEMLRIWKVYVCKKRIRRMINVWSCGVTLFVMLMGSYPFEDPNDPKDFQKTIQHLVAGFSMSYKSDCACRQLIKRHCKTILQKIILESLLSKMVLEKTVLESTIFLKKDIIKQFFRKLF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo