SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g14410

Feature Type:gene_model
Chromosome:Gm18
Start:14228642
stop:14231556
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G06680AT Annotation by Michelle Graham. TAIR10: photosystem II subunit P-1 | chr1:2047940-2049186 FORWARD LENGTH=263 SoyBaseE_val: 8.00E-139ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009637GO-bp Annotation by Michelle Graham. GO Biological Process: response to blue light SoyBaseN/AISS
GO:0009644GO-bp Annotation by Michelle Graham. GO Biological Process: response to high light intensity SoyBaseN/AISS
GO:0009657GO-bp Annotation by Michelle Graham. GO Biological Process: plastid organization SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009773GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthetic electron transport in photosystem I SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010114GO-bp Annotation by Michelle Graham. GO Biological Process: response to red light SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0010218GO-bp Annotation by Michelle Graham. GO Biological Process: response to far red light SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009543GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid lumen SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009654GO-cc Annotation by Michelle Graham. GO Cellular Compartment: oxygen evolving complex SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0019898GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extrinsic to membrane SoyBaseN/AISS
GO:0030095GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast photosystem II SoyBaseN/AISS
GO:0031977GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
PF01789PFAM PsbP JGI ISS
UniRef100_I1N123UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1N123_SOYBN SoyBaseE_val: 0ISS
UniRef100_P16059UniRef Annotation by Michelle Graham. Most informative UniRef hit: Oxygen-evolving enhancer protein 2, chloroplastic n=1 Tax=Pisum sativum RepID=PSBP_PEA SoyBaseE_val: 7.00E-157ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g41660 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g114900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g14410.1   sequence type=CDS   gene model=Glyma18g14410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCTCGACACAATGCTTTTTGCACCACCACGCCCTCACCACTCCAGCTAGAGCTTCAACACAGCGCCTAGTTGTGAGCACCAAACCAAACCACATTGTTTGCAAGGCAGCACAGAAGCAGGTTACTGTCCAAGAGGGTGAGGACACTACTACTGGCCTTGTCTCTCGCAGGTTGGCCCTCACTGTGCTCATTGGTGCTGCTGCTGTTGGCTCTAAGGTGGCACCTGCTGATGCAGCCTATGGAGAAGCTGCCAATGTGTTTGGAAAACCAAAGACAAACACAGACTTCCTTTCATACAATGGGAATGGATTCAAACTCTCAATTCCCTCAAAGTGGAACCCAAGCAAAGAGGTTGAGTACCCAGGTCAGGTTCTTAGATATGAGGACAATTTTGATTCAACCAGCAATGTTGCTGTCATGGTCACTGCAACTGACAAGAAGTCCATCACTGACTATGGTTCACCTGAGGAGTTCCTATCTCAGGTGGATTACTTGCTTGGAAAACAAGCCTTCTTTGGCCAAACTGATGCTGAGGGTGGTTTTGATTCCAATGCTGTGGCAACTGCAAATATCTTGGAGAGTTCAACGCCTGTCGTTGATGGGAAACAGTACTACAGTTTGACTGTGTTGACAAGGACAGCTGATGGAGATGAAGGTGGCAAGCACCAGCTGATTACAGCAACAGTGAAAGATGGCAAACTATACATTTGCAAGGCTCAAGCTGGAGACAAGAGGTGGTTTAAGGGAGCAAGAAGATTTGTGGAGAGCACAGCAAGTTCTTTCAGTGTTGCCTAA

>Glyma18g14410.1   sequence type=predicted peptide   gene model=Glyma18g14410   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASTQCFLHHHALTTPARASTQRLVVSTKPNHIVCKAAQKQVTVQEGEDTTTGLVSRRLALTVLIGAAAVGSKVAPADAAYGEAANVFGKPKTNTDFLSYNGNGFKLSIPSKWNPSKEVEYPGQVLRYEDNFDSTSNVAVMVTATDKKSITDYGSPEEFLSQVDYLLGKQAFFGQTDAEGGFDSNAVATANILESSTPVVDGKQYYSLTVLTRTADGDEGGKHQLITATVKDGKLYICKAQAGDKRWFKGARRFVESTASSFSVA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo