SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma18g14071

Feature Type:gene_model
Chromosome:Gm18
Start:13587591
stop:13592353
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40260AT Annotation by Michelle Graham. TAIR10: Homeodomain-like superfamily protein | chr2:16816818-16818473 REVERSE LENGTH=410 SoyBaseE_val: 8.00E-25ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_D9ZJ75UniRef Annotation by Michelle Graham. Most informative UniRef hit: MYBR domain class transcription factor n=1 Tax=Malus x domestica RepID=D9ZJ75_MALDO SoyBaseE_val: 3.00E-25ISS
UniRef100_UPI0002338989UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338989 related cluster n=1 Tax=unknown RepID=UPI0002338989 SoyBaseE_val: 1.00E-125ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g14071 not represented in the dataset

Glyma18g14071 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma08g41735 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g113400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g14071.1   sequence type=CDS   gene model=Glyma18g14071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAATTCTAAGAAAACTGGAGTACGGAAGTACCACAAATCGGAAAATCCACGCTTGCGGTGGACACCTGAACTCCATGAATACTTTGTTGAAGTTGTGGAAGGTCTTGGTGGAAAAAACAAGGCAACACCAAAGAGCATTCTGCAGATGATGCATGTGAAAGGACTGAGGATCTCTCACATTAAAAGCCATCTTCAGATGTACAGGAGCATGAAGGGACATACGATTCTCGCATCAATGCAACAGGAGATGGAAGAAAATGTGCATGTTAACGACCATCACTCAATCTGCTCCAACTGTTCATCCCAAAGATCACAAGAAATTCACCCGTTAGAAAGTAAAGGACTTTCACAGACCAGTGAAACTGATAATTACGATCTAAATCAGGAACCCGAGTCAAGTGCTTGTTTATTTAGTGATACGTCAAATGAAGAAAATAGTAGGACAATGAAATTTCTTGATCTCTCATTCTCTTTCGGCTCTCCACTAACTCCAACGATTGACGGTGATCAAGAGAGAATGCGTTTCTCTTCGCCAAATACAGCAGATAATATTCATGTCATCGATTCTAATTCTGTAGAATCTCATGGGAGCAATTATATAAATTTAGACCTAACAATATGA

>Glyma18g14071.1   sequence type=predicted peptide   gene model=Glyma18g14071   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKNSKKTGVRKYHKSENPRLRWTPELHEYFVEVVEGLGGKNKATPKSILQMMHVKGLRISHIKSHLQMYRSMKGHTILASMQQEMEENVHVNDHHSICSNCSSQRSQEIHPLESKGLSQTSETDNYDLNQEPESSACLFSDTSNEENSRTMKFLDLSFSFGSPLTPTIDGDQERMRFSSPNTADNIHVIDSNSVESHGSNYINLDLTI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo