SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g12710): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g12710): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g12710

Feature Type:gene_model
Chromosome:Gm18
Start:11930269
stop:11931244
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g12710
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G58840AT Annotation by Michelle Graham. TAIR10: Tropomyosin-related | chr3:21757499-21758455 REVERSE LENGTH=318 SoyBaseE_val: 2.00E-11ISS
GO:0007005GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrion organization SoyBaseN/AISS
GO:0007031GO-bp Annotation by Michelle Graham. GO Biological Process: peroxisome organization SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005777GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisome SoyBaseN/AISS
GO:0005778GO-cc Annotation by Michelle Graham. GO Cellular Compartment: peroxisomal membrane SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0031966GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial membrane SoyBaseN/AISS
UniRef100_I1N0W6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1N0W6_SOYBN SoyBaseE_val: 6.00E-117ISS
UniRef100_Q6DT75UniRef Annotation by Michelle Graham. Most informative UniRef hit: AT1G06530 (Fragment) n=1 Tax=Arabidopsis lyrata subsp. petraea RepID=Q6DT75_ARALP SoyBaseE_val: 1.00E-07ISS

Expression Patterns of Glyma18g12710
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g12710 not represented in the dataset
Glyma18g12710 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g12710 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g106700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g12710
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g12710
>Glyma18g12710.1   sequence type=CDS   gene model=Glyma18g12710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGCGGCGAACGGCGTCGTGTCGAAGAAGATCGAGGCGTTGGAGCGCGAGAACGCGGCCAAGAAGGACGAGATCCGGAGGCTGAAGAAGGAGATCGATTCGCTCCGGCGCGAGGCGGCGGAGCTGCGGGACTCGGAGACGAGCGCGGCGCTGAAGAACCTCCTCGAAGAGAGAGAACGAACGGTGACATTCCTAGAGAGAGAAACAGAATCTCTGAAACAGTTGAAAGCAGAGAGCGAGATGAAGGTTCGCGATCTGGAGCGGAAGCTAAGCGTTGTGGAAGTGAGGGAGAGCGAGGAGCGCAGCAAGAGGGTTAGGGCGGAGGAAGAGACCAAAGAGAAGGTTGGGGAGAAAGAGAGAGAGATTGAAGAGATGAGACAGAGAATTGAAGATTTGGAGAAAGTTAGAGTTGTGGAAATGAGAGAGAAAGGAGAGAGAGTGGATGGCGAATGGACGAAGTGGTTGGGGATTGTGTGGCCGGTGGTGGCGACGGGGAGTGGAGCCGTTGCTGCGGTGTTCTATCTCTGTTTTCGAAAACGCAGTAGGTGA
Predicted protein sequences of Glyma18g12710
>Glyma18g12710.1   sequence type=predicted peptide   gene model=Glyma18g12710   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEAANGVVSKKIEALERENAAKKDEIRRLKKEIDSLRREAAELRDSETSAALKNLLEERERTVTFLERETESLKQLKAESEMKVRDLERKLSVVEVRESEERSKRVRAEEETKEKVGEKEREIEEMRQRIEDLEKVRVVEMREKGERVDGEWTKWLGIVWPVVATGSGAVAAVFYLCFRKRSR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo