Glyma18g11990 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g11990

Feature Type:	gene_model
Chromosome:	Gm18
Start:	10787875
stop:	10791548
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g11990

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G50900	AT	Annotation by Michelle Graham. TAIR10: Ankyrin repeat family protein \| chr1:18866272-18867014 FORWARD LENGTH=175	SoyBase	E_val: 2.00E-73	ISS
GO:0006098	GO-bp	Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt	SoyBase	N/A	ISS
GO:0006655	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process	SoyBase	N/A	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0080167	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to karrikin	SoyBase	N/A	ISS
GO:0090391	GO-bp	Annotation by Michelle Graham. GO Biological Process: granum assembly	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_C6SYF4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SYF4_SOYBN	SoyBase	E_val: 6.00E-128	ISS
UniRef100_Q8VY88	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein LHCP TRANSLOCATION DEFECT n=1 Tax=Arabidopsis thaliana RepID=LTD_ARATH	SoyBase	E_val: 1.00E-70	ISS

Expression Patterns of Glyma18g11990

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g11990

Paralog	Evidence	Comments
Glyma02g25260	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g11990 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g102100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g11990

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g11990

Limit To All Plant Sequences

>Glyma18g11990.1   sequence type=CDS   gene model=Glyma18g11990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTATCTCATGCATCACCCACCACCCCATCACTTCCAAGCTCAATAATGCCTTCTCTTCACCCCACGTCTCTGCCTCAAACTTGGCCTCACGGTTTCTGGGCACCAGAAAAAGAGTTGGGTTGCATAGCCTCACCTCTAGAATAATTGGACCCTCTAATGGCTCCAAAGCCACATGCTGGTTCAGGTTCGGCAAGAACGGTGTTGATGCCAAAGGTGCTGGCATCTATGGCAGCCAGGGCCGTGATGACTTTGATAGAGATGACGTGGAACAGTACTTCAACTATATGGGGATGCTCGCTGTAGAAGGAACATATGATAAAATGGAAGCTCTTCTAAGCCAAAACATCCACCCCGTGGACATCCTTCTCCTGTTAGCTGCCTCAGAAAGTGACAAGCCAAAAATTGAAGAACTCTTGAGAGCTGGAGCAAAATACGATGTAAAAGATGCAGATGGACGGACGGCGTTGGATAGGGCTACCGACGAAATTAAAGATTTCATTCTTAATTTTTCCGTGCAGAGGGCATGA

Predicted protein sequences of Glyma18g11990

Limit To All Plant Sequences

>Glyma18g11990.1   sequence type=predicted peptide   gene model=Glyma18g11990   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASISCITHHPITSKLNNAFSSPHVSASNLASRFLGTRKRVGLHSLTSRIIGPSNGSKATCWFRFGKNGVDAKGAGIYGSQGRDDFDRDDVEQYFNYMGMLAVEGTYDKMEALLSQNIHPVDILLLLAASESDKPKIEELLRAGAKYDVKDADGRTALDRATDEIKDFILNFSVQRA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain