Glyma18g10120 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g10120

Feature Type:	gene_model
Chromosome:	Gm18
Start:	8926560
stop:	8930043
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g10120

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G26780	AT	Annotation by Michelle Graham. TAIR10: Co-chaperone GrpE family protein \| chr4:13485066-13486560 REVERSE LENGTH=327	SoyBase	E_val: 4.00E-99	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0006626	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion	SoyBase	N/A	ISS
GO:0009220	GO-bp	Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0010286	GO-bp	Annotation by Michelle Graham. GO Biological Process: heat acclimation	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0000774	GO-mf	Annotation by Michelle Graham. GO Molecular Function: adenyl-nucleotide exchange factor activity	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0042803	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity	SoyBase	N/A	ISS
GO:0051087	GO-mf	Annotation by Michelle Graham. GO Molecular Function: chaperone binding	SoyBase	N/A	ISS
KOG3003	KOG	Molecular chaperone of the GrpE family	JGI		ISS
PTHR21237	Panther	GRPE PROTEIN	JGI		ISS
PTHR21237:SF6	Panther	GRPE PROTEIN, MITOCHONDRIAL	JGI		ISS
PF01025	PFAM	GrpE	JGI		ISS
UniRef100_C6TCW7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TCW7_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1N0J3	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: GrpE protein homolog n=1 Tax=Glycine max RepID=I1N0J3_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma18g10120

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g10120

Paralog	Evidence	Comments
Glyma08g43430	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g10120 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g090400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g10120

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g10120

Limit To All Plant Sequences

>Glyma18g10120.1   sequence type=CDS   gene model=Glyma18g10120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTGCTTACAGGGTTTTGTCCCGTTCCTCTGCCATCCTTTCTCGAAGCTTCACCCTTTTCTCTGTTTCACGAAATTCCCAACCTTTCTCCACCACCCTGTCCAATAACTTCCATTCCCTCCTTCACCCATCTCCCAACAAGCTGATTCCGGTTCAAACCAATTTTCTGAATTCATCATTGACTTCGAGATTCGGGTTTTCTTCAACGGCCTCGCATGAGCATGCAAGTGAAGAAGCAAAGGTATCTGATCAGTCTGAACAAGCTGAAGCTGCGGATCAAACCAAAGAATCAGATGTAGAGAGTGAATGTGATCTGTCCAGGGATGATTTGATAAAGCTTGTTGCTGAGAAGGAACAACTTTTGAAGTTGAAGCACAAGGAGATTGAGAAAATGCAGGATAAAGTTCTGCGAACTTATGCAGAGATGGAGAATGTCATGGATAGGACAAGACGTGAAGCAGAGAATTCGAAAAAATTTGCTATACAGAATTTTGCAAAGAGTTTACTAGACGTTGCTGATAATTTGGGAAGAGCTTCCTCAGTTGTAAAGGACAACTTTTCAAAAATTGAATCTCCTGAGGAGTCTTCTGAAGCAGCACAACTCCTGAAAACACTTCTAGAAGGTGTTGAAATGACAGAGAAACAACTTGCAGAGGTACTCAAAAAGTTTGGTGTGGAAAAATTTGATCCTACAAATGAGCCATTTGATCCACACATGCACAATGCCATCTTCCAAATCCCTGATGCTTCGAAGGCCCCTGGCACTGTTGGAGTTGTTCTGAAGGCAGGATATAAGCTCTATGATCGTGTTCTTCGTCCGGCAGAAGTTGGTGTAACTCAAGAAGTGGAGGATAACAAAGCAGCTGAGTGA

Predicted protein sequences of Glyma18g10120

Limit To All Plant Sequences

>Glyma18g10120.1   sequence type=predicted peptide   gene model=Glyma18g10120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFAYRVLSRSSAILSRSFTLFSVSRNSQPFSTTLSNNFHSLLHPSPNKLIPVQTNFLNSSLTSRFGFSSTASHEHASEEAKVSDQSEQAEAADQTKESDVESECDLSRDDLIKLVAEKEQLLKLKHKEIEKMQDKVLRTYAEMENVMDRTRREAENSKKFAIQNFAKSLLDVADNLGRASSVVKDNFSKIESPEESSEAAQLLKTLLEGVEMTEKQLAEVLKKFGVEKFDPTNEPFDPHMHNAIFQIPDASKAPGTVGVVLKAGYKLYDRVLRPAEVGVTQEVEDNKAAE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain