SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g09421

Feature Type:gene_model
Chromosome:Gm18
Start:8330242
stop:8335953
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g09421
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G50575AT Annotation by Michelle Graham. TAIR10: Putative lysine decarboxylase family protein | chr1:18728862-18730296 REVERSE LENGTH=306 SoyBaseE_val: 7.00E-83ISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016831GO-mf Annotation by Michelle Graham. GO Molecular Function: carboxy-lyase activity SoyBaseN/AISS
PF03641PFAM Possible lysine decarboxylase JGI ISS
UniRef100_B9SSR4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Carboxy-lyase, putative n=1 Tax=Ricinus communis RepID=B9SSR4_RICCO SoyBaseE_val: 3.00E-86ISS
UniRef100_I1KYF9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1KYF9_SOYBN SoyBaseE_val: 7.00E-105ISS

Expression Patterns of Glyma18g09421
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g09421 not represented in the dataset
Glyma18g09421 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g09421
ParalogEvidenceComments
Glyma08g43700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g09421 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g084600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g09421
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g09421
>Glyma18g09421.1   sequence type=CDS   gene model=Glyma18g09421   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGCTTCGTTGGGTACCCATGTTGTGCTGAGAGGCACTCATGAAACGAGAATCAGAGCCACTTTTTGTGCAGAAAAGAACAGAATAATAGAATTGGTTTCAAGTTCTCAAAGCACAAGGCCGTTCAAAGAGCAATCTTTGTTAGCCAGCAAGAGTTCGCTGGGTTGGATGAGAGGAAGAGCCCAGATGAGAGTAGGGAGAGGAGTTGTGTATTTGGGTTCTTCAAGGATGGGACCTAGCCATTCACATTATGTGCAAGCACAAGATCTGGCTAAAGAGATAGAAAATCTTTTGGACTGCACTACTTGGTCAGGGGGACCAGGACTAATGGATGCTGTTACTGAAGGTGCTATGCTAGCAGGAAAACCAGTTGGTGGATTCAAGATAGGAAGAGAAGCTGGGGAATGGACTGCATCTAACTTTCATCCATACTTATCATCCGAAAATTACCTCACGTGCAGGTTTTTCCCTGCAAGGAAGCATGGGCTAGTGGATGCTGTAGTGAGGAACAATTCATTTGATAAGACTGCTGTTGTTGCCCTTCCTTGTGGGATTGATACTTTAGATGAGGTGTTTGAGATACTGGCATTGATTCAGCTGGAATGGATTGGATCAAAGCTTCATGTTCCCTTCCTGTTGATGAACTATGATTCATTTATTCAAAGCTGCTTGAATTTTTAA
Predicted protein sequences of Glyma18g09421
>Glyma18g09421.1   sequence type=predicted peptide   gene model=Glyma18g09421   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAASLGTHVVLRGTHETRIRATFCAEKNRIIELVSSSQSTRPFKEQSLLASKSSLGWMRGRAQMRVGRGVVYLGSSRMGPSHSHYVQAQDLAKEIENLLDCTTWSGGPGLMDAVTEGAMLAGKPVGGFKIGREAGEWTASNFHPYLSSENYLTCRFFPARKHGLVDAVVRNNSFDKTAVVALPCGIDTLDEVFEILALIQLEWIGSKLHVPFLLMNYDSFIQSCLNF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo