Glyma18g08400 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g08400

Feature Type:	gene_model
Chromosome:	Gm18
Start:	7169225
stop:	7171521
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g08400

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G07680	AT	Annotation by Michelle Graham. TAIR10: emp24/gp25L/p24 family/GOLD family protein \| chr3:2455627-2456652 FORWARD LENGTH=208	SoyBase	E_val: 2.00E-90	ISS
GO:0006886	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular protein transport	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0005789	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum membrane	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0030134	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ER to Golgi transport vesicle	SoyBase	N/A	ISS
GO:0008320	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein transmembrane transporter activity	SoyBase	N/A	ISS
KOG1692	KOG	Putative cargo transport protein EMP24 (p24 protein family)	JGI		ISS
PTHR22811	Panther	COPII-COATED VESICLE MEMBRANE PROTEIN	JGI		ISS
PTHR22811:SF8	Panther	COATED VESICLE MEMBRANE PROTEIN	JGI		ISS
PF01105	PFAM	emp24/gp25L/p24 family/GOLD	JGI		ISS
UniRef100_G7IV10	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transmembrane emp24 domain-containing protein n=1 Tax=Medicago truncatula RepID=G7IV10_MEDTR	SoyBase	E_val: 8.00E-100	ISS
UniRef100_I1N093	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1N093_SOYBN	SoyBase	E_val: 1.00E-108	ISS

Expression Patterns of Glyma18g08400

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g08400

Paralog	Evidence	Comments
Glyma08g44300	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g08400 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g075800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g08400

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g08400

Limit To All Plant Sequences

>Glyma18g08400.2   sequence type=CDS   gene model=Glyma18g08400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAATCTTTTCCAGCCTGAATGCAGTGCTTGGGATCAGATTTGTGATTGACAGAGAAGACTGTTTCTCTCATAATGTTCAATATGAAGGGGATAGAGTCCAGGCTTCATTTGTTGTGATCAAGATTGATACATCTTGGCAATATACTAATGATGGTGTAGACCTTTCGGTGAAGGGACCTTCTGGTGAAACAATTAAAGAATTTCATGACATGACAAGTGAAATATTCGAATTTGTGGCTCGAGACAATGGACCTCATCGCTTCTGCTTCACCAACAAGTCTCCCTATCATGAAACAATTGATTTTGATGTCCATTCTAACCACGTTCATTTCACTGATCAGCATGCAAAAGATGAGCATTTAACTCCTTTGTTAGATCAGATAACGAAGTTAGAGCATGCACTTTTCAACATTCAGTATGAACAGCATTGGCTTGAGGCTCAGACAGAACGCCAGGCAATAGTAAGCAATGCATTGAGCTCCAGAACACTTCACAAGGCCATACTTGAATCAATGGCACTAATGGGAGCCAGCGCCCTCCAAGTTTATCTTCTTCGTCGCCTCTTTGAAAGAAAGCTTGCAATATAG

Predicted protein sequences of Glyma18g08400

Limit To All Plant Sequences

>Glyma18g08400.2   sequence type=predicted peptide   gene model=Glyma18g08400   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVIFSSLNAVLGIRFVIDREDCFSHNVQYEGDRVQASFVVIKIDTSWQYTNDGVDLSVKGPSGETIKEFHDMTSEIFEFVARDNGPHRFCFTNKSPYHETIDFDVHSNHVHFTDQHAKDEHLTPLLDQITKLEHALFNIQYEQHWLEAQTERQAIVSNALSSRTLHKAILESMALMGASALQVYLLRRLFERKLAI*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain