SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma18g08250

Feature Type:gene_model
Chromosome:Gm18
Start:7033376
stop:7037491
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g08250
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G56200AT Annotation by Michelle Graham. TAIR10: embryo defective 1303 | chr1:21030852-21031886 FORWARD LENGTH=154 SoyBaseE_val: 6.00E-19ISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0016558GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into peroxisome matrix SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0090056GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chlorophyll metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_A8MS46UniRef Annotation by Michelle Graham. Most informative UniRef hit: Embryo defective 1303 protein n=1 Tax=Arabidopsis thaliana RepID=A8MS46_ARATH SoyBaseE_val: 4.00E-16ISS
UniRef100_UPI000233F532UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233F532 related cluster n=1 Tax=unknown RepID=UPI000233F532 SoyBaseE_val: 1.00E-110ISS

Expression Patterns of Glyma18g08250
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g08250
ParalogEvidenceComments
Glyma08g44560 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g08250 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g074400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g08250
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g08250
>Glyma18g08250.1   sequence type=CDS   gene model=Glyma18g08250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTGGCTATTAGTGCAATTGCATCTTTGCCCGTATTACCACCAGTCAGAAGAGGTGGCCACTGCATTGAACAGAATGTTGTTTCCACATTGAGCTTTCCAAGACGACTACAGACAACTAATAATTCAATATCTCTGAGTAGTACACAGTTTCCATTCGGTAGAAGAGCTCGTTCTACGCAGCCAGCAACTATAATATGTGCTGCAGCTTTGAATGCAAGATGTGGTGCAGAGCAAACCCAAACTGTTACTCGCCAGGCTCCTACAATTACTCATGTTCCTGGCAAGGAGAAGTCACCACAACTCGACGATGGTGGAACTGGATTTCCGCCTCGTGATGATGATGATGGTGGTGGTGGAGGAGGTGGAGGCGGAGGCAACTGGTCTGGTGGATTCTTCTTTTTTGGCTTTCTTGCTTTTCTTGGCTTCTTAAAGGATAAGGAAACTGAAGACACATACAGGGATGACCGAAGAAGGTGA
Predicted protein sequences of Glyma18g08250
>Glyma18g08250.1   sequence type=predicted peptide   gene model=Glyma18g08250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLAISAIASLPVLPPVRRGGHCIEQNVVSTLSFPRRLQTTNNSISLSSTQFPFGRRARSTQPATIICAAALNARCGAEQTQTVTRQAPTITHVPGKEKSPQLDDGGTGFPPRDDDDGGGGGGGGGGNWSGGFFFFGFLAFLGFLKDKETEDTYRDDRRR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo