|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT2G38170 | AT | Annotation by Michelle Graham. TAIR10: cation exchanger 1 | chr2:15989429-15993178 REVERSE LENGTH=463 | SoyBase | E_val: 0 | ISS |
| GO:0006812 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cation transport | SoyBase | N/A | ISS |
| GO:0006816 | GO-bp | Annotation by Michelle Graham. GO Biological Process: calcium ion transport | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0006882 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular zinc ion homeostasis | SoyBase | N/A | ISS |
| GO:0007030 | GO-bp | Annotation by Michelle Graham. GO Biological Process: Golgi organization | SoyBase | N/A | ISS |
| GO:0009624 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to nematode | SoyBase | N/A | ISS |
| GO:0009631 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cold acclimation | SoyBase | N/A | ISS |
| GO:0009651 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to salt stress | SoyBase | N/A | ISS |
| GO:0009750 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus | SoyBase | N/A | ISS |
| GO:0019761 | GO-bp | Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process | SoyBase | N/A | ISS |
| GO:0030003 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis | SoyBase | N/A | ISS |
| GO:0030026 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular manganese ion homeostasis | SoyBase | N/A | ISS |
| GO:0032880 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of protein localization | SoyBase | N/A | ISS |
| GO:0044242 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular lipid catabolic process | SoyBase | N/A | ISS |
| GO:0055062 | GO-bp | Annotation by Michelle Graham. GO Biological Process: phosphate ion homeostasis | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0070838 | GO-bp | Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport | SoyBase | N/A | ISS |
| GO:0005773 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuole | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0009705 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plant-type vacuole membrane | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0005515 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein binding | SoyBase | N/A | ISS |
| GO:0008324 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0015085 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium ion transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0015368 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium:cation antiporter activity | SoyBase | N/A | ISS |
| GO:0015369 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: calcium:hydrogen antiporter activity | SoyBase | N/A | ISS |
| KOG1397 | KOG | Ca2+/H+ antiporter VCX1 and related proteins | JGI | ISS | |
| PF01699 | PFAM | Sodium/calcium exchanger protein | JGI | ISS | |
| UniRef100_G7KE49 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Vacuolar cation/proton exchanger n=1 Tax=Medicago truncatula RepID=G7KE49_MEDTR | SoyBase | E_val: 0 | ISS |
| UniRef100_UPI000233E9F6 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233E9F6 related cluster n=1 Tax=unknown RepID=UPI000233E9F6 | SoyBase | E_val: 0 | ISS |
|
Glyma18g07060 not represented in the dataset |
Glyma18g07060 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.18g063200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma18g07060.2 sequence type=CDS gene model=Glyma18g07060 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGACACACCACACCATGGAGGAGGACTTGAACATCTTGGAGGTTAACACTGAGCCTTGCAACAACAATGCTATTACAAGTGCAAAGATTGCACCACCACAGGGAAAGAACCTTAGTCCAAATGTAACAAAGAAGTGTCTATTTCTGGTCACCAAACTTCGCTTCCAAATGCTCGGCAATTTCACAACCAATTTGCGAGAGGTCATTTTTGGGACTAAGCTTGCAGTGCTTTTTCCTGCTGTCCCTTTAGCTGTTGTTGCAGATTTTTATAAACTTGGAAGACCTTGGATTTTTGCTTTGAGCCTACTTGGACTCACCCCTCTAGCTGAACGTGTCAGCTTCCTTACTGAGCAAATTGCGTATTACACTGGCCCCACAGTTGGAGGGCTTCTGAATGCAACCTGTGGTAATGCAACTGAGATGATCATATCTTTGCTAGCACTTCACCAAAACAAAGTAAATGTTGTGAAGTTCTCTCTGCTGGGATCTATTTTCTCAAACCTTCTATTAGTTCTTGGAAGCTCACTCCTTTGTGGTGGCTTAGCCAACCTTAGGAAGGAACAAAGATATGACAGAAAACAGGCAGATGTAAACTCACTACTTTTGTTGCTGGGGTTGCTATGCCATTTGCTGCCATTACTGCTCAGATATGCCTTAGCAGGAGAATATCCTTCTATAGCCACTAGTAATCTACAATTGTCAAGAGCAAGCAGCATTGTTATGCTTCTAGCATATGCTGGATACATCTTTTTTCAATTAAAAACACATCGACAACTTTTTGATGCACAAGAGGAAGATGAAAATGAAGATGAAGAGAAGGCTGTGATAGGATTTTGGAGTGCATTTTCTTGGTTGGTCGGTATGACACTTATCATATCTCTGCTTTCTGAATATGTTGTTGCAACCATTGAGGCTGCTTCAGATTCTTGGGGCATTTCTGTTAGCTTCATTAGCATAATTTTGTTACCAATTGTTGGGAACGCTGCAGAACATGCTGGCTCAATCATATTTGCTTTCAAGAACAAGTTGGACATATCTTTGGGGGTTGCTATGGGATCTGCAACCCAAATTTCTATGTTTGTGGTTCCATTTAGTGTGGTTGTTGCATGGATAATGGGTATAGAAATGGACTTGGATTTCAATCTCCTTGAAACTGGGTGTCTTGCTTTTACAATTATTGTTACAGCATTCACTTTGCAGGATGGAACTTCACACTACCTGAAAGGAGTGGTTCTTTTCCTGTGTTACATCATCATTGCTGCATGCTTTTTTGTTCATAAAACTAGTACTCCACTAATCAATCAAGCATAG
>Glyma18g07060.2 sequence type=predicted peptide gene model=Glyma18g07060 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MTHHTMEEDLNILEVNTEPCNNNAITSAKIAPPQGKNLSPNVTKKCLFLVTKLRFQMLGNFTTNLREVIFGTKLAVLFPAVPLAVVADFYKLGRPWIFALSLLGLTPLAERVSFLTEQIAYYTGPTVGGLLNATCGNATEMIISLLALHQNKVNVVKFSLLGSIFSNLLLVLGSSLLCGGLANLRKEQRYDRKQADVNSLLLLLGLLCHLLPLLLRYALAGEYPSIATSNLQLSRASSIVMLLAYAGYIFFQLKTHRQLFDAQEEDENEDEEKAVIGFWSAFSWLVGMTLIISLLSEYVVATIEAASDSWGISVSFISIILLPIVGNAAEHAGSIIFAFKNKLDISLGVAMGSATQISMFVVPFSVVVAWIMGIEMDLDFNLLETGCLAFTIIVTAFTLQDGTSHYLKGVVLFLCYIIIAACFFVHKTSTPLINQA*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||