SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g05120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g05120): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g05120

Feature Type:gene_model
Chromosome:Gm18
Start:3867641
stop:3873453
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G45130AT Annotation by Michelle Graham. TAIR10: RAB homolog 1 | chr5:18244495-18246060 FORWARD LENGTH=200 SoyBaseE_val: 3.00E-120ISS
GO:0007034GO-bp Annotation by Michelle Graham. GO Biological Process: vacuolar transport SoyBaseN/AISS
GO:0007264GO-bp Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0015031GO-bp Annotation by Michelle Graham. GO Biological Process: protein transport SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG0092 KOG GTPase Rab5/YPT51 and related small G protein superfamily GTPases JGI ISS
PTHR24073Panther FAMILY NOT NAMED JGI ISS
PTHR24073:SF254Panther SUBFAMILY NOT NAMED JGI ISS
PF00071PFAM Ras family JGI ISS
UniRef100_G7J7Y2UniRef Annotation by Michelle Graham. Most informative UniRef hit: GTP binding protein n=1 Tax=Medicago truncatula RepID=G7J7Y2_MEDTR SoyBaseE_val: 5.00E-144ISS
UniRef100_UPI00019A9E81UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00019A9E81 related cluster n=1 Tax=unknown RepID=UPI00019A9E81 SoyBaseE_val: 8.00E-147ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g05120 not represented in the dataset

Glyma18g05120 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g33100 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g045000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g05120.2   sequence type=CDS   gene model=Glyma18g05120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACGATCGGACACAACAATCTCAATGCCAAATTGGTTCTTCTCGGGGACATGGGTGCTGGGAAATCCAGCCTCGTTTTGCGCTTTGTCAAGGGTCAATTTCTCGAATTTCAGGAATCAACAATAGGGGCAGCGTTCTTTTCACAGACGCTGGCAGTAAATGACGCGACGGTAAAGTTTGAGATATGGGACACAGCAGGACAAGAGAGGTACCATAGCTTGGCTCCCATGTATTACAGAGGTGCTGCTGCTGCTATCATTGTCTATGACATCACTAGCTCGGACTCCTTTACCCGAGCTAAGAAGTGGGTCCAAGAGCTTCAAAAGCAAGGGAATCCTAATATGGTCATGGCTCTTGCTGGTAACAAAGCTGATTTGGAAGATAAGAGGAAAGTGACAGCTGAAGAAGCACGTGTATATGCTGAAGAAAATGGTTTGTTTTTCATGGAGACCTCTGCCAAAACTGCATCCAACGTTAATGATATATTCTATGAAATAGCCAAGAGGTTACCAAGGGCTCAGCCAGCTCAGAACCCAGCTGGGATGGTACTTGTTGATAGACCCGCCGAAGGAACTAGGGCTGCATCATGTTGTTCATAA

>Glyma18g05120.2   sequence type=predicted peptide   gene model=Glyma18g05120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATIGHNNLNAKLVLLGDMGAGKSSLVLRFVKGQFLEFQESTIGAAFFSQTLAVNDATVKFEIWDTAGQERYHSLAPMYYRGAAAAIIVYDITSSDSFTRAKKWVQELQKQGNPNMVMALAGNKADLEDKRKVTAEEARVYAEENGLFFMETSAKTASNVNDIFYEIAKRLPRAQPAQNPAGMVLVDRPAEGTRAASCCS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo