SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g03930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g03930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g03930

Feature Type:gene_model
Chromosome:Gm18
Start:2717630
stop:2719711
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11410AT Annotation by Michelle Graham. TAIR10: protein phosphatase 2CA | chr3:3584181-3585649 REVERSE LENGTH=399 SoyBaseE_val: 2.00E-140ISS
GO:0006470GO-bp Annotation by Michelle Graham. GO Biological Process: protein dephosphorylation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009788GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0010119GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of stomatal movement SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004721GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphoprotein phosphatase activity SoyBaseN/AISS
GO:0004722GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine phosphatase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG0698 KOG Serine/threonine protein phosphatase JGI ISS
PTHR13832Panther PROTEIN PHOSPHATASE 2C JGI ISS
PTHR13832:SF115Panther SUBFAMILY NOT NAMED JGI ISS
PF00481PFAM Protein phosphatase 2C JGI ISS
UniRef100_Q9M3V1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein phpsphatase 2C (PP2C) n=1 Tax=Fagus sylvatica RepID=Q9M3V1_FAGSY SoyBaseE_val: 8.00E-175ISS
UniRef100_UPI00018C6F14UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00018C6F14 related cluster n=1 Tax=unknown RepID=UPI00018C6F14 SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g03930 not represented in the dataset

Glyma18g03930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g34410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g035000 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g03930.1   sequence type=CDS   gene model=Glyma18g03930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGGAATTTGCTGTGGTGTTGTTGGAGAAGGTGACACTCCGGCTCCACTCGAGCCCACTCCTCGCCCCTCCAGGCGCCGGAGTTTGGACATCTTACCTTTAAAATATATCGCCGACATGCCCATGCCGCCGCCGGAGGCTTTACGGAAGCGTCCCAAGCTCAACCTCAGGGACTGCGATAACGCAATTGAAAATTGCGACGAATCCACTGGACACAAGGTGACGAAGAAGGAATCCAAAGTAGACTACGACGACGACGTCGTTTCGGAAACTAAGAACGTAACTGTTTCGGAAGTTGAAGAAGAATCTCCCAAGTTCGGCGTGACGTCCGTTTGCGGCAGGAGAAGAGACATGGAAGATTCCGTCTCGGTGCGGCCTTGCTTCACCCAAGGCTTCCACTACTTCGGCGTCTTCGACGGTCACGGTTGCTCTCATGTTGCGACTATGTGTAAGGAGCGGCTACACGAGATCGTGAATGAAGAAATTGAAAGCGCGCGCGAGAATTTGGAGTGGAAACTGACGATGGAGAACGGATTCGCTCGCATGGACGACGAGGTTCATCGCCGGAGCCAGAGCAACCAGACCTTCACCTGCAGGTGTGAGCTCCAGACTCCTCACTGCGACGCCGTCGGATCCACCGCCGTCGTCGCCGTCGTCACGCCGGACAAAATCGTCGTCTCTAACTGCGGCGACTCCCGCGCCGTCCTCTGCCGCAACGGCGTCGCCATCCCTCTCTCCTCCGATCACAAGCCGGATCGACCCGACGAATTACTCCGAGTCCAATCCAAGGGAGGGCGCGTGATTTACTGGGACGGTCCGAGAGTGCTTGGTGTGTTAGCAATGTCTCGAGCCATAGGTGACAATTATCTGAAGCCGTACGTGATTTCAGAACCGGAGGTGATGGTGACGGAGCGGACGGAGGAGGACGAGTGTTTGATACTGGCGAGTGATGGGTTGTGGGATGTGGTATCGAATGAGACCGCATGTGGGGTGGTGAGGATGTGCCTCAAGGCGCAGAAGCCGCCGGGGTCTCCGGGGAGTGACGTGGCGGCTGACGGTTCCGACCGTGCTTGCTCCGATGCGTCGATTCTGTTGACCAAGTTGGCGCTGGCAAGGCATAGTTCGGATAATGTGAGCGTGGTGGTGGTTGATTTGAGGAGGGATCAACGACAATCATCAAACTACAACGACGTTAATTAA

>Glyma18g03930.1   sequence type=predicted peptide   gene model=Glyma18g03930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAGICCGVVGEGDTPAPLEPTPRPSRRRSLDILPLKYIADMPMPPPEALRKRPKLNLRDCDNAIENCDESTGHKVTKKESKVDYDDDVVSETKNVTVSEVEEESPKFGVTSVCGRRRDMEDSVSVRPCFTQGFHYFGVFDGHGCSHVATMCKERLHEIVNEEIESARENLEWKLTMENGFARMDDEVHRRSQSNQTFTCRCELQTPHCDAVGSTAVVAVVTPDKIVVSNCGDSRAVLCRNGVAIPLSSDHKPDRPDELLRVQSKGGRVIYWDGPRVLGVLAMSRAIGDNYLKPYVISEPEVMVTERTEEDECLILASDGLWDVVSNETACGVVRMCLKAQKPPGSPGSDVAADGSDRACSDASILLTKLALARHSSDNVSVVVVDLRRDQRQSSNYNDVN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo