SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g03300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g03300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g03300

Feature Type:gene_model
Chromosome:Gm18
Start:2209232
stop:2211983
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g03300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G09200AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L10 family protein | chr3:2823364-2825020 REVERSE LENGTH=320 SoyBaseE_val: 8.00E-168ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0006414GO-bp Annotation by Michelle Graham. GO Biological Process: translational elongation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009664GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall organization SoyBaseN/AISS
GO:0010043GO-bp Annotation by Michelle Graham. GO Biological Process: response to zinc ion SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0042545GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall modification SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
KOG0815 KOG 60S acidic ribosomal protein P0 JGI ISS
PTHR21141Panther 60S ACIDIC RIBOSOMAL PROTEIN FAMILY MEMBER JGI ISS
PTHR21141:SF3Panther 60S ACIDIC RIBOSOMAL PROTEIN P0 JGI ISS
PF00466PFAM Ribosomal protein L10 JGI ISS
UniRef100_I1MZ41UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MZ41_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q9M5M5UniRef Annotation by Michelle Graham. Most informative UniRef hit: 60S acidic ribosomal protein PO (Fragment) n=1 Tax=Euphorbia esula RepID=Q9M5M5_EUPES SoyBaseE_val: 6.00E-173ISS

Expression Patterns of Glyma18g03300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g03300 not represented in the dataset
Glyma18g03300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma18g03300
ParalogEvidenceComments
Glyma11g35060 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma18g03300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g029200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g03300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g03300
>Glyma18g03300.1   sequence type=CDS   gene model=Glyma18g03300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAGGAAACTGACGAAAGCGCAGAAGAAGATAGCATACGATGCGAAGCTGTGCAAGCTTCTGGACAACTACACCCAAATTCTGGTGGTGGCTGCGGACAACGTCGGATCGAACCAGCTTCAGAACATTCGACACGGTCTGCGTGGCGACTCGGTCATTCTGATGGGAAAGAACACCATGATGAAGCGAACTATTAAGATCCATGCCCAGAACACCGGCAACACCACCATCCTCAACCTTATTCCCCTTCTTGTCGGTAACGTGGGGCTGATTTTCACCAAAGGTGACGTCAAGGAGGTTAAGGAAGTGGTTTCCAAGTACAAGGTGGCAGCTCCTGCTCGTGTAGGTTTAGTTGCACCTATTGATGTTGTTGTTCCCCCAGGCAACACAGGGCTGGATCCCTCTCAGACCTCTTTCTTTCAGGTGCTTAACATCCCTACCAAGATTAATAAGGGTACTGTGGAAATTATCACCCCTGTGGAACTCATTATGAAGGGAGACAAGGTTGGCTCTTCTGAAGCTGCTTTGCTTTCCAAGCTTGCGATAAGGCCCTTCTCATATGGGCTTGCTGTCGTTTCTGTTTATGAGAATGGTTCAGTTTTTAGCCCTGAGGTTCTTGATCTCACTGAAGATGACCTCGTTGTGAAGTTTGCTGAGGGTGTCTGTATGGTGTCTTCACTTTCCTTGGCTATCTCCTACCCATCCATTGCAGCTGCTCCACACATGTTTGTCAATTCCTACAAGAACATCCTGGCTGTTGCAGTGGCAACCGAATATTCGTTCCCTGAGGCAGACAAGGTTAAGGAGTACTTGAAGGATCCTACTGCAGCATCCAAGGTGGAGGATAAGAAGGAAGAAGCCGCAGATGAATCCGATGATGACATGGGCTTCAGTTTGTTTGATTAA
Predicted protein sequences of Glyma18g03300
>Glyma18g03300.1   sequence type=predicted peptide   gene model=Glyma18g03300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARKLTKAQKKIAYDAKLCKLLDNYTQILVVAADNVGSNQLQNIRHGLRGDSVILMGKNTMMKRTIKIHAQNTGNTTILNLIPLLVGNVGLIFTKGDVKEVKEVVSKYKVAAPARVGLVAPIDVVVPPGNTGLDPSQTSFFQVLNIPTKINKGTVEIITPVELIMKGDKVGSSEAALLSKLAIRPFSYGLAVVSVYENGSVFSPEVLDLTEDDLVVKFAEGVCMVSSLSLAISYPSIAAAPHMFVNSYKNILAVAVATEYSFPEADKVKEYLKDPTAASKVEDKKEEAADESDDDMGFSLFD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo