Glyma18g03290 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g03290): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g03290): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g03290

Feature Type:	gene_model
Chromosome:	Gm18
Start:	2205322
stop:	2207937
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma18g03290

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G40010	AT	Annotation by Michelle Graham. TAIR10: Ribosomal protein L10 family protein \| chr2:16708578-16710448 REVERSE LENGTH=317	SoyBase	E_val: 3.00E-107	ISS
GO:0001510	GO-bp	Annotation by Michelle Graham. GO Biological Process: RNA methylation	SoyBase	N/A	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0006414	GO-bp	Annotation by Michelle Graham. GO Biological Process: translational elongation	SoyBase	N/A	ISS
GO:0042254	GO-bp	Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0022626	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0815	KOG	60S acidic ribosomal protein P0	JGI		ISS
PTHR21141	Panther	60S ACIDIC RIBOSOMAL PROTEIN FAMILY MEMBER	JGI		ISS
PTHR21141:SF3	Panther	60S ACIDIC RIBOSOMAL PROTEIN P0	JGI		ISS
PF00428	PFAM	60s Acidic ribosomal protein	JGI		ISS
PF00466	PFAM	Ribosomal protein L10	JGI		ISS
UniRef100_I1MZ40	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MZ40_SOYBN	SoyBase	E_val: 3.00E-122	ISS
UniRef100_Q9M5M5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 60S acidic ribosomal protein PO (Fragment) n=1 Tax=Euphorbia esula RepID=Q9M5M5_EUPES	SoyBase	E_val: 1.00E-114	ISS

Expression Patterns of Glyma18g03290

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g03290 not represented in the dataset	Glyma18g03290 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g03290 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.18g029100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma18g03290

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma18g03290

Limit To All Plant Sequences

>Glyma18g03290.2   sequence type=CDS   gene model=Glyma18g03290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGTGATACCCACGAAAGCGGAGAAGAAGGTGTCGTACGATGTGAAGCTGTGCCAACTTCTAGAGGATTACACCCAAATTCTGGTAGTGGCTGCGGACAACGTTGGATCAAACCAACTTGAGAACATTCGAAAGGATCTACGTGGCGACTCGGTGTGTAATTTGAAGGAGGTTAGCGAAGAGGTTGCCAGGTACAAGTTGGTAGCTCCTGCTCGTGTAGGGTTGGTTGCACCTATTGATGTTGTTGTTCCTCCTGGCAACACAGGGCTGGATCCCTCTCAAACCTCTTTCTTTCAGATTAATAAGGGTACTGTGGAAATCATCACCCCTGTAGAACTCATTAAGAAGGGAGACAAGGTTGGCTCTTCTGAAGCTGTGTTGCTTTCCAAGCTTGCGATAAGGCCCTTCTCTTATGGGCTTGTTGTCGTTTCTGTTTATGACAATGGTTCATTTTTTAGCCCTGAGGTTCTTGATCTCACTGAAGATGACCTCATTGACAAGTTTTCTGTTGCTGCACCACACATGTTTGGCAATGCTTATAAGAACGTCCTTGCTGTTGCAGTGGCAACAGAATATTCATTCCCAGAAGCAGACAAGGTTAAGGAGTACTTGAAGGTATTCACTGCTCCAGCTACTGCCTCCAAGGAGGAGGAAAAGAAGGAAGAACCAGCAGAAGAATCTGACGATGACATGGGTTTCAGTTTGTTTGATTAA

Predicted protein sequences of Glyma18g03290

Limit To All Plant Sequences

>Glyma18g03290.2   sequence type=predicted peptide   gene model=Glyma18g03290   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVIPTKAEKKVSYDVKLCQLLEDYTQILVVAADNVGSNQLENIRKDLRGDSVCNLKEVSEEVARYKLVAPARVGLVAPIDVVVPPGNTGLDPSQTSFFQINKGTVEIITPVELIKKGDKVGSSEAVLLSKLAIRPFSYGLVVVSVYDNGSFFSPEVLDLTEDDLIDKFSVAAPHMFGNAYKNVLAVAVATEYSFPEADKVKEYLKVFTAPATASKEEEKKEEPAEESDDDMGFSLFD*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain