SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g03270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g03270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g03270

Feature Type:gene_model
Chromosome:Gm18
Start:2178778
stop:2184270
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma18g03270
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G05730AT Annotation by Michelle Graham. TAIR10: anthranilate synthase alpha subunit 1 | chr5:1719740-1722811 REVERSE LENGTH=595 SoyBaseE_val: 0ISS
GO:0000162GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan biosynthetic process SoyBaseN/AISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006567GO-bp Annotation by Michelle Graham. GO Biological Process: threonine catabolic process SoyBaseN/AISS
GO:0006569GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan catabolic process SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009058GO-bp Annotation by Michelle Graham. GO Biological Process: biosynthetic process SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009851GO-bp Annotation by Michelle Graham. GO Biological Process: auxin biosynthetic process SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010311GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root formation SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005950GO-cc Annotation by Michelle Graham. GO Cellular Compartment: anthranilate synthase complex SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004049GO-mf Annotation by Michelle Graham. GO Molecular Function: anthranilate synthase activity SoyBaseN/AISS
GO:0016833GO-mf Annotation by Michelle Graham. GO Molecular Function: oxo-acid-lyase activity SoyBaseN/AISS
KOG1223 KOG Isochorismate synthase JGI ISS
PTHR11236Panther AMINOBENZOATE/ANTHRANILATE SYNTHASE JGI ISS
PTHR11236:SF9Panther ANTHRANILATE SYNTHASE COMPONENT I JGI ISS
PF00425PFAM chorismate binding enzyme JGI ISS
PF04715PFAM Anthranilate synthase component I, N terminal region JGI ISS
UniRef100_G7JB70UniRef Annotation by Michelle Graham. Most informative UniRef hit: Anthranilate synthase alpha n=1 Tax=Medicago truncatula RepID=G7JB70_MEDTR SoyBaseE_val: 0ISS
UniRef100_UPI000233E42EUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E42E related cluster n=1 Tax=unknown RepID=UPI000233E42E SoyBaseE_val: 0ISS

Expression Patterns of Glyma18g03270
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g03270 not represented in the dataset
Glyma18g03270 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma18g03270 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g028900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma18g03270
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma18g03270
>Glyma18g03270.2   sequence type=CDS   gene model=Glyma18g03270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTTTCTGCAACACTTCCAGTGTCCCTTACATCTGCAAAGGGCTCCTCCTTGGCCTTCTCCCGCCGCATGGTTCCTTCCGGCCACCGTCTATCTCCGGCGACACTCACCGGCGTTTCACTCTCACGCGCTCCTCTCACGTTGAGGTGCTCTTCACTCTCAAACACCCCTTCCTATGTTGAGGAAGGAAGAAAGTTTGTAGAAGCTTCAAAGAATGGGAACTTGATTCCTCTCTGTCAGAGCATCTTCGCTGACCAACTCACTCCTGTCCTTGCTTACCGGATTTTGGTTAAGGAAGACGATTGGGAGGCTCCAAGCTTTCTTTTAGAGTCTGCAGAGCCTAGTTATCATGCTTCGAGTGTTGGGCGCTATAGTGTTTTAGGAGCAAACCCAACTATGGAAGTTGTGGCAAAAGAAAATAAGGTTACAATAATTGACCACGAATCTGGGAATTTAACTGAGGAAATTGTTGATGATCCTATGGTGATTCCCAGAAAAATCTCAGAGGGTTGGAAACCCTATCTCATTGATGAACTACCAGATGCATTCTGTGGTGGTTGGGCAGGTTATTTCTCATATGACACTGTTCGTTATGTGGAAAAGAAAAAGCTACCATTTTCAAACGCTCCAGAGGATGACAGGAACCTTGCTGACATACATCTGGGCCTCTATGAGAATGTGATTGTGTTTGACCATGTAGAAAAGAAAGCATATGTGATTCTTTGGGTGAGGGTTGATCGGTACTCCTCGGCTGAGAGTGCTTATAAGGATGGAATGGAAAGATTAGAAAAATTAGTGGCCAAATTACAAGATGGCCAACCCCCAAGGCTGGCTCCAGGTTCTGTGGATTTACATACTCATCATTTTGGTCCATCTTTAAAGAAGTCAAGCATGACAAGTGAAGCATACAAAGAGGCAGTCCTTCAGGCAAAAGAACATATTAAAGCAGGGGATATTTTCCAGATTGTATTAAGTCAGAGATTCGAACGAAGAACATTTGCTGATCCTTTTGAAATTTATAGAGCATTGAGAGTTGTTAACCCAAGTCCTTATATGGCCTATTTGCAGGCTAGGGGATGTATTCTGGTTGCTTCAAGTCCAGAGATTCTTACACGTGTAAAGAAGAATAAGATTATGAACCGTCCATTGGCTGGGACAGCTAGAAGGGGGAAAACACCTGAAGAAGATGCAAGGTTTGAAGCAATATTGCTGAGAGATGAAAAGCAGTGTGCAGAGCATGTCATGTTGGTTGATTTGGGACGCAATGATGTTGGAAAGGTTGCAAAAAGTGGTTCTGTCAAAGTTGAAAAGCTTATGAATGTTGAACGATATTCCCATGTCATGCACATAAGTTCAACGGTTACTGGAGAGTTGCAAGAGCATTTGACTAGCTGGGATGCCCTGCGAGCTGCATTGCCCGTTGGAACTGTCAGTGGAGCACCAAAGGTGAAGGCGATGGAGTTGATTGATGAGCTGGAGGTGACAAGGAGGGGGCCTTACAGTGGAGGATTTGGATACATCTCTTTCTCTGGTGAGATGGACATTGCTCTTGCTCTCAGGACAATGGTATTTCCGAGCGGAACCAGGTATGATACAATGTACTCATACAAAGACGTCGACCAACGCCGCGAGTGGATTGCTTACCTTCAAGCCGGAGCTGGTATAGTTGCTGACAGTGTCCCTGATGATGAGCACCAAGAGTGTCAAAACAAAGCTGCTGGTCTTGCTCGTGCCATTGATTTGGCTGAGTCCGCTTTTGTTGATAAATGA
Predicted protein sequences of Glyma18g03270
>Glyma18g03270.2   sequence type=predicted peptide   gene model=Glyma18g03270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLSATLPVSLTSAKGSSLAFSRRMVPSGHRLSPATLTGVSLSRAPLTLRCSSLSNTPSYVEEGRKFVEASKNGNLIPLCQSIFADQLTPVLAYRILVKEDDWEAPSFLLESAEPSYHASSVGRYSVLGANPTMEVVAKENKVTIIDHESGNLTEEIVDDPMVIPRKISEGWKPYLIDELPDAFCGGWAGYFSYDTVRYVEKKKLPFSNAPEDDRNLADIHLGLYENVIVFDHVEKKAYVILWVRVDRYSSAESAYKDGMERLEKLVAKLQDGQPPRLAPGSVDLHTHHFGPSLKKSSMTSEAYKEAVLQAKEHIKAGDIFQIVLSQRFERRTFADPFEIYRALRVVNPSPYMAYLQARGCILVASSPEILTRVKKNKIMNRPLAGTARRGKTPEEDARFEAILLRDEKQCAEHVMLVDLGRNDVGKVAKSGSVKVEKLMNVERYSHVMHISSTVTGELQEHLTSWDALRAALPVGTVSGAPKVKAMELIDELEVTRRGPYSGGFGYISFSGEMDIALALRTMVFPSGTRYDTMYSYKDVDQRREWIAYLQAGAGIVADSVPDDEHQECQNKAAGLARAIDLAESAFVDK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo