SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma18g03211): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma18g03211): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma18g03211

Feature Type:gene_model
Chromosome:Gm18
Start:2124108
stop:2129749
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G05690AT Annotation by Michelle Graham. TAIR10: Cytochrome P450 superfamily protein | chr5:1702907-1706705 REVERSE LENGTH=472 SoyBaseE_val: 0ISS
GO:0000271GO-bp Annotation by Michelle Graham. GO Biological Process: polysaccharide biosynthetic process SoyBaseN/AISS
GO:0009825GO-bp Annotation by Michelle Graham. GO Biological Process: multidimensional cell growth SoyBaseN/AISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009911GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of flower development SoyBaseN/AISS
GO:0009932GO-bp Annotation by Michelle Graham. GO Biological Process: cell tip growth SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0010268GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid homeostasis SoyBaseN/AISS
GO:0010584GO-bp Annotation by Michelle Graham. GO Biological Process: pollen exine formation SoyBaseN/AISS
GO:0010817GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hormone levels SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048657GO-bp Annotation by Michelle Graham. GO Biological Process: tapetal cell differentiation SoyBaseN/AISS
GO:0048767GO-bp Annotation by Michelle Graham. GO Biological Process: root hair elongation SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0019825GO-mf Annotation by Michelle Graham. GO Molecular Function: oxygen binding SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0157 KOG Cytochrome P450 CYP4/CYP19/CYP26 subfamilies JGI ISS
PTHR24286Panther FAMILY NOT NAMED JGI ISS
PTHR24286:SF58Panther JGI ISS
PF00067PFAM Cytochrome P450 JGI ISS
UniRef100_Q9LKH7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 n=1 Tax=Vigna radiata RepID=Q9LKH7_VIGRA SoyBaseE_val: 0ISS
UniRef100_UPI000233E42DUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233E42D related cluster n=1 Tax=unknown RepID=UPI000233E42D SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma18g03211 not represented in the dataset

Glyma18g03211 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma11g35150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.18g028300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma18g03211.1   sequence type=CDS   gene model=Glyma18g03211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCTTTGCCAGCTTTGCCAACACTCCTCCTCTCGTTCGCCGCCATCTTCTTCACCGTCCTCCTCCTCCTCCTCTTCCTCCGCCGCCGGCAGCTCCGCCTCCCGCCGGGGAGCTACGGCTTGCCGTTGATCGGCGAGACGCTGCAACTGATATCGGCGTACAAGAGCGACAATCCAGAGCCGTTCATCGACGAGCGCGTGGAGCGGTACGGGTCGATCTTCACGACGCACGTGTTCGGAGAGGCGACGGTGTTCTCGGCGGATCCGGAGGTGAACCGGTTCATTCTGCAGAACGAAGGGAGGCTGTTGGATTGCAGCTACCCCGGTTCGATATCGAACCTGCTGGGAAAACACTCTCTTCTGTTGATGAAAGGTGGTCTCCACAAGAGAATGCACTCTCTGACGATGAGCTTGGCCAATTCCTCCATCATCAAGGATCATCTTCTTCACCACATCGACCGCCTCGTCTGCCTCAACTTGGACGCCTGGTCCAACCGCGTCTTTCTTATGGACCAGGCAAAAAAGATAACATTTGAGCTAACGGTGAAGCAGTTGATGAGCTTTGACCCAGATGAATGGACTGAGAATCTAAGAAAAGAGTATGTTCTTGTGATTGAAGGATTCTTCACTCTCCCTTTTCCTCTCTTCTCCACCACATACCGCAGAGCCATCAAGGCAAGAACAAAGGTGGCAGAGGCACTAACGTTGGTAGTAAGGCAGAGGAGAAAAGAGTATGATGAAGACAAAGAGAAAAAGAATGACATGCTTGGGGCACTGTTGGCCTCCGGCGACCACTTTTCCGACGAGGAAATAGTGGATTTTTTGTTGGCTTTGCTCGTCGCCGGTTATGAGACCACCTCTACCATAATGACTCTTGCGATCAAGTTCCTCACTGAGACTCCCCTGGCCTTGGCACAGCTCAAGGAAGAGCATGACCAAATCAGAGCAAGAAGTGACCCAGGGACACCACTGGAATGGACCGATTACAAGTCAATGGCGTTTACTCAATGTGTTGTGAATGAGACCTTGAGAGTGGCAAACATAATTGGTGGGATTTTTAGGAGAGCAAGGACAGACATTGACATAAAAGGTTACACTATTCCTAAGGGATGGAAAGTCTTTGCATCATTTCGTGCTGTACATCTGAATCCTGAACATTACAAAGATGCCCGGTCCTTCAATCCCTGGAGATGGCAGAGTAACTCATCAGAAGCAACAAACCCTGGTAATGTTTATACACCATTTGGAGGAGGGCCACGGTTGTGCCCTGGCTATAAGCTAGCCAGAGTTGTACTTTCCGTCTTCCTTCACCGCATTGTTACCCGCTTCAGTTGGGTTCCTGCTGAGGAAGATAAGTTGGTGTTTTTCCCAACTACTAGGACGCAGAAGAGGTATCCAATTATTGTGCAGCGTAGAGACTAG

>Glyma18g03211.1   sequence type=predicted peptide   gene model=Glyma18g03211   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASLPALPTLLLSFAAIFFTVLLLLLFLRRRQLRLPPGSYGLPLIGETLQLISAYKSDNPEPFIDERVERYGSIFTTHVFGEATVFSADPEVNRFILQNEGRLLDCSYPGSISNLLGKHSLLLMKGGLHKRMHSLTMSLANSSIIKDHLLHHIDRLVCLNLDAWSNRVFLMDQAKKITFELTVKQLMSFDPDEWTENLRKEYVLVIEGFFTLPFPLFSTTYRRAIKARTKVAEALTLVVRQRRKEYDEDKEKKNDMLGALLASGDHFSDEEIVDFLLALLVAGYETTSTIMTLAIKFLTETPLALAQLKEEHDQIRARSDPGTPLEWTDYKSMAFTQCVVNETLRVANIIGGIFRRARTDIDIKGYTIPKGWKVFASFRAVHLNPEHYKDARSFNPWRWQSNSSEATNPGNVYTPFGGGPRLCPGYKLARVVLSVFLHRIVTRFSWVPAEEDKLVFFPTTRTQKRYPIIVQRRD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo