SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma17g38210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma17g38210): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma17g38210

Feature Type:gene_model
Chromosome:Gm17
Start:41848054
stop:41849712
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G20930AT Annotation by Michelle Graham. TAIR10: cyclin-dependent kinase B2;2 | chr1:7292752-7294664 REVERSE LENGTH=315 SoyBaseE_val: 0ISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0007346GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of mitotic cell cycle SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009755GO-bp Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway SoyBaseN/AISS
GO:0009934GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of meristem structural organization SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004693GO-mf Annotation by Michelle Graham. GO Molecular Function: cyclin-dependent protein kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG0594 KOG Protein kinase PCTAIRE and related kinases JGI ISS
PTHR24056Panther CELL DIVISION PROTEIN KINASE JGI ISS
PTHR24056:SF101Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_C6TIH1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TIH1_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q6T2Z8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cyclin-dependent kinases CDKB n=1 Tax=Glycine max RepID=Q6T2Z8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g38210 not represented in the dataset

Glyma17g38210 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma14g39760 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g262300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma17g38210.1   sequence type=CDS   gene model=Glyma17g38210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGAAGCCAGGAGGAGGAGGAGTGTTATCGGCGAAGGAGGCATTCGAGAAGCTTGAAAAGGTGGGAGAAGGGACATATGGGAAGGTGTACAGAGCAAGAGAGAAGGCCACGGGGAAGATCGTGGCTCTGAAGAAGACTCGTCTCCACGAGGACGAAGAAGGTGTCCCTCCCACCACTCTCCGTGAGGTTTCCATTCTGCGAATGCTCTCTCGCGATCCCCATGTCGTTAGGTTAATGGATGTCAAACAAGGTCAGAACAAGGAAGGGAAGACAGTGCTCTACTTGGTCTTTGAGTACATGGACACCGATCTCAAGAAATTCATTCGCTCTTTCCGTCAAACTGGACAAACCGTTCCACCCCAAACCATCAAAAGCTTGATGTACCAGCTTTGCAAGGGCGTTGCTTTCTGCCACGGTCATGGGATCTTGCACAGGGACTTGAAACCTCACAATCTCTTGATGGACCCAAAAACCATGATGCTTAAAATTGCTGATCTTGGACTCGCTCGAGCATTTACTGTGCCGATTAAGAAATATACACATGAGATACTAACCCTGTGGTATAGAGCTCCTGAAGTCCTCTTGGGTGCTACCCATTACTCAATGGCGGTGGACATTTGGTCCGTAGGCTGCATATTTGCCGAACTTGTCACCAAACAAGCACTCTTTCCTGGTGATTCCGAACTGCAACAACTCCTGCATATATTCAGGCTATTGGGTACTCCCAACGAAGACGTGTGGCCAGGCGTGAGTAAACTAATGAACTGGCATGAATACCCTCAATGGAACCCTCAAAGTCTGTCAACGGCTGTTCCAAGTTTGGATGAGCTTGGACTGGATTTGCTATCTCAAATGTTGAAATATGAGCCTTCCAAGAGGATTTCTGCAAAGAAAGCAATGGAACATGCTTACTTTGATGACTTGGACAAGAGGCACCTTTAG

>Glyma17g38210.1   sequence type=predicted peptide   gene model=Glyma17g38210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEKPGGGGVLSAKEAFEKLEKVGEGTYGKVYRAREKATGKIVALKKTRLHEDEEGVPPTTLREVSILRMLSRDPHVVRLMDVKQGQNKEGKTVLYLVFEYMDTDLKKFIRSFRQTGQTVPPQTIKSLMYQLCKGVAFCHGHGILHRDLKPHNLLMDPKTMMLKIADLGLARAFTVPIKKYTHEILTLWYRAPEVLLGATHYSMAVDIWSVGCIFAELVTKQALFPGDSELQQLLHIFRLLGTPNEDVWPGVSKLMNWHEYPQWNPQSLSTAVPSLDELGLDLLSQMLKYEPSKRISAKKAMEHAYFDDLDKRHL*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo