Glyma17g35960 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g35960

Feature Type:	gene_model
Chromosome:	Gm17
Start:	39922806
stop:	39926055
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g35960

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G45976	AT	Annotation by Michelle Graham. TAIR10: S-ribonuclease binding protein 1 \| chr1:17199371-17200680 FORWARD LENGTH=325	SoyBase	E_val: 1.00E-152	ISS
GO:0007165	GO-bp	Annotation by Michelle Graham. GO Biological Process: signal transduction	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009755	GO-bp	Annotation by Michelle Graham. GO Biological Process: hormone-mediated signaling pathway	SoyBase	N/A	ISS
GO:0048573	GO-bp	Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
KOG1100	KOG	Predicted E3 ubiquitin ligase	JGI		ISS
PTHR12183	Panther	UNCHARACTERIZED RING ZINC FINGER-CONTAINING PROTEIN	JGI		ISS
UniRef100_G7I3I5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Baculoviral IAP repeat-containing protein n=1 Tax=Medicago truncatula RepID=G7I3I5_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_UPI000233E68B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233E68B related cluster n=1 Tax=unknown RepID=UPI000233E68B	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma17g35960

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g35960

Paralog	Evidence	Comments
Glyma14g09211	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g35960 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g241100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g35960

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g35960

Limit To All Plant Sequences

>Glyma17g35960.1   sequence type=CDS   gene model=Glyma17g35960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTTTCCTCAGCACCACTTCCAACAGCACTACCAAACCCAACAGCAACAACAGCCACAAAACAAATCCTTCAGAAATCTGCAAACAATCGATGGTCAGATGTCACAGCAGGTGGCGTTTTACAACCCTACTGATTTGCAAGATCAATCCCAACATCCACCCTACATTCCTCCATTTCATGTTGTTGGGTTTGCTCCGGGTCCTGTTCCTCCTGCTGATGGCAGTGATGGTGGAGTTGATTTGCAATTGCAATGGAATTATGGTTTGGAGCCAGAGAGGAAGAGACTAAAAGAACAGGATTTTTTGGAGAACAATTCTCAGATATCTTCTGTTGATTTCCTTCAACCACGATCAGTGTCGACTGGGTTGGGCTTGTCACTAGACAATACTCGCCTGACATCCACTGGAGACTCAGCTTTGTTGTCACTCATCGGTGATGACATCGAGCGTGAGTTGCAGCAGCAGGACGCAGAGATAGATAGATTTCTCAAAGTGCAGGGTGGACGTTTGCGGCAAGCAGTCTTGGAGAAGGTTCAGGCAACACAGCTTCAGAGTGTCTCACTAATTGAAGACAAAATCCTTCAGAAACTTCGCGAGAAAGAAGCTATGGTAGAAAGCATCAACAAGAGGAACATTGAACTCGAAGATCAAATGGAGCAGTTGACTGTGGAAGCTGGTTCGTGGCAACAGCGAGCAAGATATAATGAAAATATGATTGCTGCTCTCAAGTTCAACCTTCAGCAAGCGTATGTCCAAAGCAGAGATAGTAAAGAAGGATGTGGTGACAGTGAGGTCGACGATACAGCTTCTTGCTGCAATGGCCGTTCCCTCGATTTTCATCTGCTTTCAAGGGAGAACACCGACATGAAAGAGATGATGACATGCAAGGCTTGCAGAGTCAATGAAGTGACCATGGTTTTGTTACCTTGTAAGCATCTTTGCCTCTGTAAAGATTGTGAAAGTAAGCTTAGTTTCTGTCCTCTATGTCAATCCTCCAAATTTATCGGCATGGAGGTCTACATGTAA

Predicted protein sequences of Glyma17g35960

Limit To All Plant Sequences

>Glyma17g35960.1   sequence type=predicted peptide   gene model=Glyma17g35960   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAFPQHHFQQHYQTQQQQQPQNKSFRNLQTIDGQMSQQVAFYNPTDLQDQSQHPPYIPPFHVVGFAPGPVPPADGSDGGVDLQLQWNYGLEPERKRLKEQDFLENNSQISSVDFLQPRSVSTGLGLSLDNTRLTSTGDSALLSLIGDDIERELQQQDAEIDRFLKVQGGRLRQAVLEKVQATQLQSVSLIEDKILQKLREKEAMVESINKRNIELEDQMEQLTVEAGSWQQRARYNENMIAALKFNLQQAYVQSRDSKEGCGDSEVDDTASCCNGRSLDFHLLSRENTDMKEMMTCKACRVNEVTMVLLPCKHLCLCKDCESKLSFCPLCQSSKFIGMEVYM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain