SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g27490

Feature Type:gene_model
Chromosome:Gm17
Start:29212332
stop:29226006
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g27490
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G32910AT Annotation by Michelle Graham. TAIR10: CONTAINS InterPro DOMAIN/s: Nuclear pore complex protein, Nucleoporin Nup85-like (InterPro:IPR011502); Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr4:15881364-15885210 FORWARD LENGTH=716 SoyBaseE_val: 0ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010074GO-bp Annotation by Michelle Graham. GO Biological Process: maintenance of meristem identity SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005635GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear envelope SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
KOG2271 KOG Nuclear pore complex component (sc Nup85) JGI ISS
PTHR13373Panther FROUNT PROTEIN-RELATED JGI ISS
PTHR13373:SF15Panther SUBFAMILY NOT NAMED JGI ISS
PF07575PFAM Nup85 Nucleoporin JGI ISS
UniRef100_A2A1E8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Nucleoporin n=1 Tax=Lotus japonicus RepID=A2A1E8_LOTJA SoyBaseE_val: 0ISS
UniRef100_I1MWB9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MWB9_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma17g27490
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g27490 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g193800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g27490
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g27490
>Glyma17g27490.1   sequence type=CDS   gene model=Glyma17g27490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCGTCGGACACCGTCGGCAACGTGGCTCTGGTCCCCTTCACCGGAGACTCGCCGCCAGCGGTATACCCTCTCCACCACGGCCTCGCTCCTCCGATTAGTCGTCTCTCCATCTCCTGGGCCCGCGGCAGCTCCCTCCGCCTCTCCCTTTTCGCCGGCGCCGCCGCCAAGGTCGTTGAAGTGAAGCTCGCCGGCGAAGATTCGGAGATCCCTGACGCTCACTGGCGCCGAATCGCGTACGGCTCCGTTGCGCCGTTTGCGCTGCTTCAGAGTCGGAGGAGCTCCCTTTCTGCTCTCTTGAAGACTCCTTCTCCCTATCGTTCGGATTGGTGGGAGCATGTGCTTCAGTATAGCAAAGAGATAGGTTCACTTCTTGGGGGGCCAAAGTTGCCTGCTAGTCCTATAATTGAGGACCCAAATGTAATTGCTAAGAGAGGTGAAGAGCCTACATCTTTGAAAGCTGCGTGGGAGTTAATTGAAATATTTTATGTGGACAAGCAATCTCAAGCATGGCTACCTGAAAGGCTTGTTGATTGGTTAGCTGATTATGCCAGCCTCTTTACTAGTACACATGAAACAATTCATGGCAAGCTTGTGGATTTTCAGAAAGAACTAGTTAACATACAGGTGATTGAGGAGGATCCCAGATATTGGGACTTGTTGTCATCTGCACTGTCAGTTGGTTGGCTTGATATTGTGGTGAAAATGCTGCGGTTGCATGGATCTTACCAATTAGATCAGCTCAGTAATCGGGAGTTGGAAAATGGACTTGTAGAGGCTGTTGCTGTTCTTATTTCCAAAATGCCCCGCATGCGTCCTGAATCTGTTGGAAAGTTAGGTGAATGCTATAAATCCAAACCTGACTTCATCAAGGCCTGGGAAAAATGGAGGTCACAAATTACAAAACTGGATTGCAGTCGATTCTGGATTCAATGTGATAATCAACAAACTCGTGAGGGCTTGAGAAACTTGCTACAAATTATGCTGGGTAACACTGAGAGTCTCTGCATGGCTACATGTTATTGGATTGAATTATATATTTCTCATTTCCTGTACATAAGGCCATTTACAATGGGAATAGAAAGCATGTATAATTTGGCCCAGAAATGCATCCAGTTGAAACCACGATCTAGTACCCATAGGTTGTCAGTACTTATGATTGGAATTCTTGAAGAAAATACCGAGGTTGTTTTAGCTGAGTGTTCCAGAGAATTTGGCCCTTGGTTGGTGGCACATGCCATAGAACTGTTGACTGCAGGGAGTGAGCAAGCAGAGATTCTTCTGCATGAGGAGCGTTATAACTTGGGGGGAATCAGCATAGTGGAACTACATCGGCTTGTATATGCTCAAATTCTATCGTCACATGCATTGACCTGGCAAATTGCTCCTATATATTTAACATCATGCATGAAGCAAGGAATGGGCTTGTTAGAGAATTTATTGTACAGGCAATCTGCTCAACATAATGATGTGTTGCTTAAGAACATTGAGATATGCCGTTTGTATGAGCTTGATCATATTAGTTCAAATATCATGAAGATTGCTGGAGTACATCACTGGAAGCATGGCCATAAGGGTGCTGGAGTATTCTGGCTTCAACAAGCCCAAGACGCAAGTTGTCTTGATAAGATTGCCCAACAGTTATTTGATTCTGTTGGAAAGTCTATATCTGATGAAAGCTTCAAGCAATGGGAAGGCATGATTGAACTATTGGGTTCTGAATCTAAGCCTGCTGGGGGACTTGAATTTTTGCACAAGTATAGGGATTTCAAGAAATCCCTTCAGAAGGTATCTAGTGGAAAATCAACTGATGCAGCAAGGCAAGCTGTAGGCTCCCTCATACTGCTTATGAAAAATCCATCTACTCCTCAGCGCTTTTGGTTGCCTCTTCTGTATGACTCGTTGAAGTTACTTAATTGGCAGGATTGCCCTCTTCTAAGTGTCTCTGAGACCAATCTTCTGCTGAACAAACTTCATGAGTTATCTCTGGCGAAGCTGCGACCGCACCATACTGAGCCTAGCTTACCTCCTGATGCACTAAGCTCTATTAGGTTGGCTCTAGCTACAAATCTTGGTCAAGCCATACTTGATGAATAG
Predicted protein sequences of Glyma17g27490
>Glyma17g27490.1   sequence type=predicted peptide   gene model=Glyma17g27490   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPSDTVGNVALVPFTGDSPPAVYPLHHGLAPPISRLSISWARGSSLRLSLFAGAAAKVVEVKLAGEDSEIPDAHWRRIAYGSVAPFALLQSRRSSLSALLKTPSPYRSDWWEHVLQYSKEIGSLLGGPKLPASPIIEDPNVIAKRGEEPTSLKAAWELIEIFYVDKQSQAWLPERLVDWLADYASLFTSTHETIHGKLVDFQKELVNIQVIEEDPRYWDLLSSALSVGWLDIVVKMLRLHGSYQLDQLSNRELENGLVEAVAVLISKMPRMRPESVGKLGECYKSKPDFIKAWEKWRSQITKLDCSRFWIQCDNQQTREGLRNLLQIMLGNTESLCMATCYWIELYISHFLYIRPFTMGIESMYNLAQKCIQLKPRSSTHRLSVLMIGILEENTEVVLAECSREFGPWLVAHAIELLTAGSEQAEILLHEERYNLGGISIVELHRLVYAQILSSHALTWQIAPIYLTSCMKQGMGLLENLLYRQSAQHNDVLLKNIEICRLYELDHISSNIMKIAGVHHWKHGHKGAGVFWLQQAQDASCLDKIAQQLFDSVGKSISDESFKQWEGMIELLGSESKPAGGLEFLHKYRDFKKSLQKVSSGKSTDAARQAVGSLILLMKNPSTPQRFWLPLLYDSLKLLNWQDCPLLSVSETNLLLNKLHELSLAKLRPHHTEPSLPPDALSSIRLALATNLGQAILDE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo