SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g22808

Feature Type:gene_model
Chromosome:Gm17
Start:22508720
stop:22510811
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g22808
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATMG01190AT Annotation by Michelle Graham. TAIR10: ATP synthase subunit 1 | chrM:302166-303689 REVERSE LENGTH=507 SoyBaseE_val: 1.00E-46ISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0015986GO-bp Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport SoyBaseN/AISS
GO:0015991GO-bp Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport SoyBaseN/AISS
GO:0046034GO-bp Annotation by Michelle Graham. GO Biological Process: ATP metabolic process SoyBaseN/AISS
GO:0005618GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cell wall SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005753GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial proton-transporting ATP synthase complex SoyBaseN/AISS
GO:0016469GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex SoyBaseN/AISS
GO:0033178GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, catalytic domain SoyBaseN/AISS
GO:0045261GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting ATP synthase complex, catalytic core F(1) SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0046933GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism SoyBaseN/AISS
GO:0046961GO-mf Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism SoyBaseN/AISS
GO:0050897GO-mf Annotation by Michelle Graham. GO Molecular Function: cobalt ion binding SoyBaseN/AISS
PTHR15184Panther ATP SYNTHASE JGI ISS
PTHR15184:SF19Panther ATP SYNTHASE ALPHA CHAIN, MITOCHONDRIAL, PUTATIVE JGI ISS
PF00006PFAM ATP synthase alpha/beta family, nucleotide-binding domain JGI ISS
PF00306PFAM ATP synthase alpha/beta chain, C terminal domain JGI ISS
UniRef100_B9VLH2UniRef Annotation by Michelle Graham. Best UniRef hit: AtpA (Fragment) n=3 Tax=Larix RepID=B9VLH2_9CONI SoyBaseE_val: 7.00E-47ISS
UniRef100_B9VLH2UniRef Annotation by Michelle Graham. Most informative UniRef hit: AtpA (Fragment) n=3 Tax=Larix RepID=B9VLH2_9CONI SoyBaseE_val: 7.00E-47ISS

Expression Patterns of Glyma17g22808
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g22808 not represented in the dataset
Glyma17g22808 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g22808 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g182100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g22808
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g22808
>Glyma17g22808.1   sequence type=CDS   gene model=Glyma17g22808   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGAAAGTTAGAATAGAAACTACAAGCAACTACCCCCCAATAGGCACAAGAGCTGAAAGGCACTGTCCCGACAGGGGTAGGAGCAAAAGGCCACTCGACAAGAGGAAAGGCTTTCGTCTGTCCTTCATTGAAACACAAGCAAGAGACATATTGGCCTATATTCCAACCGATGTGATCTCCATTACTGCTGGACAAATATGTTTGAAAACAGAGTTCTTTTATCGCGGAATTAGACTTGCTATTAATGATGGCTTATCTGTCAGTCGCGTTGGGTCTGCTACTCAGTTGAAAGCTACGGAACAAGTCTGCGTCGTCGCCTTTGCTCAATTTGACTCAGACCTTGATGCTGCGACTCAGGCATTACTCAATAGTGGTGCAAGGCTTACAGAAGTACTAAAACAACCTCAATATGCATCACTTCCAATTGAAAAATGA
Predicted protein sequences of Glyma17g22808
>Glyma17g22808.1   sequence type=predicted peptide   gene model=Glyma17g22808   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGKVRIETTSNYPPIGTRAERHCPDRGRSKRPLDKRKGFRLSFIETQARDILAYIPTDVISITAGQICLKTEFFYRGIRLAINDGLSVSRVGSATQLKATEQVCVVAFAQFDSDLDAATQALLNSGARLTEVLKQPQYASLPIEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo