Glyma17g21540 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g21540

Feature Type:	gene_model
Chromosome:	Gm17
Start:	20917544
stop:	20919496
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g21540

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G60200	AT	Annotation by Michelle Graham. TAIR10: TARGET OF MONOPTEROS 6 \| chr5:24241078-24241951 FORWARD LENGTH=257	SoyBase	E_val: 8.00E-32	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009855	GO-bp	Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry	SoyBase	N/A	ISS
GO:0009944	GO-bp	Annotation by Michelle Graham. GO Biological Process: polarity specification of adaxial/abaxial axis	SoyBase	N/A	ISS
GO:0010014	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem initiation	SoyBase	N/A	ISS
GO:0010075	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of meristem growth	SoyBase	N/A	ISS
GO:0048364	GO-bp	Annotation by Michelle Graham. GO Biological Process: root development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
PF02701	PFAM	Dof domain, zinc finger	JGI		ISS
UniRef100_I1MW20	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MW20_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q0GLD7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Dof15 (Fragment) n=1 Tax=Glycine max RepID=Q0GLD7_SOYBN	SoyBase	E_val: 1.00E-166	ISS

Expression Patterns of Glyma17g21540

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g21540 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g180600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g21540

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g21540

Limit To All Plant Sequences

>Glyma17g21540.1   sequence type=CDS   gene model=Glyma17g21540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATCCAAGAATTGTTGGGTGGTGCCCTCATAGCAGGAGAAAGAAAACCTTCCTCCATTAATGGAGGAGGTGGAGGAGGAGGAGTTTTACTCCCAATTACTACACCTTCTCCTTCTTCTTTTCCCTCTTCCACGACCAGTGATGTTACCCTCACATCCACAACAACAACTGCTGCTACTACTGCTGCTACTGCTGCTACTACTACTACTGCTGTCGAAAACCTGAGATGTCCTCGATGTGATTCATCGAACACCAAGTTTTGTTACTACAACAACTACAACCTCACTCAGCCGCGGCACTTCTGCAAGACGTGCCGCCGCTACTGGACCAAAGGTGGGGCTCTCCGGAACGTCCCCATCGGAGGCGGATGCCGGAAGAATAAGAGCATTGGCGTGGCGAGCTCGGTGGCGGGGAAGACAGCCTCGACCAAGATGAAAACCATTGCATCGGAGTTTGGAAAATCGCCGGGCTTTGGCGGTGGGTTCGAGGTGGAACACGAACTTCCGCCACCACCGGGCCAAATCCTCTGGGGATCGCCCCAAAACACCCACCTTCTAGCCTTGCTGAGAGCTACACAAACTCAAAACCCTAACCCTAACCCTAGTCCCATGTCCCTCAAGGAAGAAGGAACCCTATTGGGCCACATGGTGAGCACTGATCAGCCCTTGGTTTCAAACACTTTGCTGAGCTACCGAACCTTAGGCTATGATGCTGTTGCGCAAGTTCCTTCTTCGCTTGGTCTGTTTGGGAGAAACAATCAAGATCAACAACAACAAAATGGAGGGTTCCTAGTTGGGGAACATCACAACAACAGTGGAATTCAAGAGCTTTACCAGAAGCTAAGGTCATCATCAACTGTTAATAATAATTATTGCAGTGATAATAACTCGTCACAAATGTTTATGGGGAACATGGCTTCTAACTATTCCTCTTCTGTGTCCAACAACATTTTGGAGACAACCTCGGTTGCTGGGGGTGAATTCGGATACTGGAATGGTCCAACTTTTTCTAATTGGTCTGATCTTCCAACCACTAATGGCGCTGGTGCATATCCGTAA

Predicted protein sequences of Glyma17g21540

Limit To All Plant Sequences

>Glyma17g21540.1   sequence type=predicted peptide   gene model=Glyma17g21540   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MIQELLGGALIAGERKPSSINGGGGGGGVLLPITTPSPSSFPSSTTSDVTLTSTTTTAATTAATAATTTTAVENLRCPRCDSSNTKFCYYNNYNLTQPRHFCKTCRRYWTKGGALRNVPIGGGCRKNKSIGVASSVAGKTASTKMKTIASEFGKSPGFGGGFEVEHELPPPPGQILWGSPQNTHLLALLRATQTQNPNPNPSPMSLKEEGTLLGHMVSTDQPLVSNTLLSYRTLGYDAVAQVPSSLGLFGRNNQDQQQQNGGFLVGEHHNNSGIQELYQKLRSSSTVNNNYCSDNNSSQMFMGNMASNYSSSVSNNILETTSVAGGEFGYWNGPTFSNWSDLPTTNGAGAYP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain