Glyma17g21480 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g21480

Feature Type:	gene_model
Chromosome:	Gm17
Start:	20807614
stop:	20809280
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g21480

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G42390	AT	Annotation by Michelle Graham. TAIR10: Insulinase (Peptidase family M16) family protein \| chr5:16945308-16952647 FORWARD LENGTH=1265	SoyBase	E_val: 4.00E-103	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0009793	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009570	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma	SoyBase	N/A	ISS
GO:0003824	GO-mf	Annotation by Michelle Graham. GO Molecular Function: catalytic activity	SoyBase	N/A	ISS
GO:0004222	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metalloendopeptidase activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
GO:0046872	GO-mf	Annotation by Michelle Graham. GO Molecular Function: metal ion binding	SoyBase	N/A	ISS
PTHR11851	Panther	METALLOPROTEASE	JGI		ISS
PTHR11851:SF34	Panther	PITRILYSIN	JGI		ISS
PF05193	PFAM	Peptidase M16 inactive domain	JGI		ISS
UniRef100_G7K558	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Metalloendopeptidase n=1 Tax=Medicago truncatula RepID=G7K558_MEDTR	SoyBase	E_val: 2.00E-117	ISS
UniRef100_I1LFY2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LFY2_SOYBN	SoyBase	E_val: 6.00E-130	ISS

Expression Patterns of Glyma17g21480

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g21480 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma17g21480

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g21480

Limit To All Plant Sequences

>Glyma17g21480.1   sequence type=CDS   gene model=Glyma17g21480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CAGTGTGCCATACCATCGGAGCTTCAAATGATGAATACAATAGAGTATCGAGTTGATTGTCAGCTGAGCATAAGGTTTCCCATTGGCTTAGAAGAACAGATAAAGAAGTGGGATGCTGATAAAATAAGGAAGTTTCATGAGCGTTGGTATTTCCCTGCAAATGCTACCTTGTACATTGTGGGGGATATTGATAACATATCAAAGACTGTTTACCATATTGAAAATCTTATACTTGTCACACATGCAATTTTTGGACAAACTGGTGCAGACAATAAGAAAGGTTCTATAGCCACTCCATGTGCATTTGGTGAAATGGCTAGTTTTCTCACTCCTAAGCTTTCTGTTGGTTTGGGTGGAAATTCTATTGAAAGATCAGCCAATGCAACGGATCAATCAAAAGTATTCAATAAGGAAAGGCAAGTTGTTCGTCCTCCTGTGAAGCATAATTGGTCACTTCCTGGGAGCGGTGTTGATTTGAAGCCACCACAAATATTTCAACATGAGTTACTTCAAAAAATTTCAATTAATATGTTCTGCAAGTTGGAGACCTTCTGTGGTGGAGAAATGGTCAATAGAGGATTTATGAAATCCCTGTTTGGGAGGTTTTTTATGATTTGCAACCTTCTTTATTCTTGCATCAGAAGGATTCTAGATTCAAATCCACCGTTCACTTCAGTTGAATTGGATCACAATGACTCTGGAAGGGAAGGATGCACTGTGACCATTCTTACCATAACTACAGAACCAAAGAATTGGCAAAATGCAATTAGAGTTGTTGTTCAAGAG

Predicted protein sequences of Glyma17g21480

Limit To All Plant Sequences

>Glyma17g21480.1   sequence type=predicted peptide   gene model=Glyma17g21480   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
QCAIPSELQMMNTIEYRVDCQLSIRFPIGLEEQIKKWDADKIRKFHERWYFPANATLYIVGDIDNISKTVYHIENLILVTHAIFGQTGADNKKGSIATPCAFGEMASFLTPKLSVGLGGNSIERSANATDQSKVFNKERQVVRPPVKHNWSLPGSGVDLKPPQIFQHELLQKISINMFCKLETFCGGEMVNRGFMKSLFGRFFMICNLLYSCIRRILDSNPPFTSVELDHNDSGREGCTVTILTITTEPKNWQNAIRVVVQE

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain