SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g20690

Feature Type:gene_model
Chromosome:Gm17
Start:19806997
stop:19811664
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g20690
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G03780AT Annotation by Michelle Graham. TAIR10: methionine synthase 2 | chr3:957602-960740 FORWARD LENGTH=765 SoyBaseE_val: 8.00E-82ISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009086GO-bp Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003871GO-mf Annotation by Michelle Graham. GO Molecular Function: 5-methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0008705GO-mf Annotation by Michelle Graham. GO Molecular Function: methionine synthase activity SoyBaseN/AISS
PTHR19960Panther TEKTIN RELATED JGI ISS
PTHR19960:SF21Panther 5-METHYLTETRAHYDROPTEROYLTRIGLUTAMATE--HOMOCYSTEIN JGI ISS
PF08267PFAM Cobalamin-independent synthase, N-terminal domain JGI ISS
UniRef100_E3VW74UniRef Annotation by Michelle Graham. Most informative UniRef hit: Pollen allergen MetE (Fragment) n=1 Tax=Amaranthus retroflexus RepID=E3VW74_AMARE SoyBaseE_val: 5.00E-88ISS
UniRef100_I1LXY2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LXY2_SOYBN SoyBaseE_val: 2.00E-96ISS

Expression Patterns of Glyma17g20690
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g20690 not represented in the dataset
Glyma17g20690 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g20690 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g178900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g20690
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g20690
>Glyma17g20690.1   sequence type=CDS   gene model=Glyma17g20690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGTATTCAAATTGTAGATTTTCATTTTGCAATGACAGAGCAATGGCATCTCATATTGTTGGTTATCCACACATAGGACCCAAGAGAGAACTTAAGTCCGCTTTGGAATCTTTTTGGGATGGAAAGAGTAATAAGCAGATGGATGATGCTGGAATAAAGTATATTCCTAGCAATGCTTTCTCATACTACGATCAAGTACTGGACACAACAACCATGCTTGGGGCAGTTCCACCTAGATATAATTGGAATTGTGGGGAGATTGGGTTTGATGTTTACTTCTTGATGGCAAGAAGGAATGCATATGTACCAGCTATGGAAAAGACCAAATGTTTTGACACAAACTATCGTTACATTGTTCCTGAATTAGGTTCAGATGTTAAGTTCTCGTATGCATCACACAAGGTTGTGGATGAATACAAAGAGGCTAAAGTTATCCTTCTTGTCTATAGGGAAGTTATGGCTGAACTAAAGGCAGCTGGTGCTACTTGGATCCAATTTGATGAACCTAACCTTGTGAAGGATCTCAATGCCCACCAGTTACAAGCATTTACTCATGCCTATACAGCGCTAGAGTCAAGTTTATCTGATTTATTTGAAACATGCTACAAGGATGAGGTGGAGGATCTTGAGAAAGCTAGTATTACTGTCATCCAAATTGATAAGGCTACTCTAAGAGAAGGATTTACCAACTATGGTGTGGAGGACACTACTCAGATTCACACTCACATGTGCTACTCCAACTTCAATGACATCATTCACCCAATCATAGACATGGATGTTGATGCTGATGTGATCACCATTCACACTCACATTTCTCTTGACCTCCAGTTAAGATAA
Predicted protein sequences of Glyma17g20690
>Glyma17g20690.1   sequence type=predicted peptide   gene model=Glyma17g20690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRYSNCRFSFCNDRAMASHIVGYPHIGPKRELKSALESFWDGKSNKQMDDAGIKYIPSNAFSYYDQVLDTTTMLGAVPPRYNWNCGEIGFDVYFLMARRNAYVPAMEKTKCFDTNYRYIVPELGSDVKFSYASHKVVDEYKEAKVILLVYREVMAELKAAGATWIQFDEPNLVKDLNAHQLQAFTHAYTALESSLSDLFETCYKDEVEDLEKASITVIQIDKATLREGFTNYGVEDTTQIHTHMCYSNFNDIIHPIIDMDVDADVITIHTHISLDLQLR*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo