SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g20391

Feature Type:gene_model
Chromosome:Gm17
Start:19378741
stop:19381504
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g20391
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G72250AT Annotation by Michelle Graham. TAIR10: Di-glucose binding protein with Kinesin motor domain | chr1:27192902-27198118 FORWARD LENGTH=1203 SoyBaseE_val: 0ISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006306GO-bp Annotation by Michelle Graham. GO Biological Process: DNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006346GO-bp Annotation by Michelle Graham. GO Biological Process: methylation-dependent chromatin silencing SoyBaseN/AISS
GO:0007018GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule-based movement SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0016458GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing SoyBaseN/AISS
GO:0031047GO-bp Annotation by Michelle Graham. GO Biological Process: gene silencing by RNA SoyBaseN/AISS
GO:0031048GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing by small RNA SoyBaseN/AISS
GO:0034968GO-bp Annotation by Michelle Graham. GO Biological Process: histone lysine methylation SoyBaseN/AISS
GO:0048451GO-bp Annotation by Michelle Graham. GO Biological Process: petal formation SoyBaseN/AISS
GO:0048453GO-bp Annotation by Michelle Graham. GO Biological Process: sepal formation SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0003777GO-mf Annotation by Michelle Graham. GO Molecular Function: microtubule motor activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
KOG0239 KOG Kinesin (KAR3 subfamily) JGI ISS
PTHR24115Panther FAMILY NOT NAMED JGI ISS
PTHR24115:SF171Panther SUBFAMILY NOT NAMED JGI ISS
PF00225PFAM Kinesin motor domain JGI ISS
UniRef100_G7IJ61UniRef Annotation by Michelle Graham. Most informative UniRef hit: Kinesin-4 n=1 Tax=Medicago truncatula RepID=G7IJ61_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1MJ41UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJ41_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma17g20391
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g20391 not represented in the dataset
Glyma17g20391 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g20391 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g177100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g20391
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g20391
>Glyma17g20391.1   sequence type=CDS   gene model=Glyma17g20391   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GGTATCGAGGATATTGGGATGGAAGCGAAGTTTAAGAGGCTAAAAAGAGACTTTGACAGTCAGAGAAAGAAGCTGACGGAAACAAGGAGGGAGTTGGGGGAGATCAAGAGAGAGAATCAACAGAAGAGTAGAGAATGCCAAGAAGCTTGGAACTCCTTGAAAGAGCTTCAAAATGAGCTAATGTGCAAGTCCATGCATGTAGGATCTTTGGCATTTGCCATTGAGGGGCAAGTGAAGGACAAAAGTAAGTGGTTTTCATCACTAAGAAACTTCACGAGGAAATTGAAGATTATGAAAATGGAACACATCAAGCTATTAGAGGAAGCAGAGGCAAGCAAAAAATATCAAGCAGATATGAGAGAAATGGGGCTTATTATTAAGTCCAAAATAAATGAACAGCTGGAGTCACATGAAGATCTCAAGTCCAAATATATTGAAGGGGCTACGGAACGGAAAGATCTTTACAATAAGGTTTTGGAGTTGAGAGGAAACATAAGGGTCTTTTGCCATTGTAGGTCTTTCAACACCAACGAGATATATGCAGGAGCAACAATGGCCTTAGATTTTGAATCTATGAAAGATGGTGATTTAACTATAATGTCAAATGGAGCTCCTAAGAAGACTTTCAAGTTTGATGTTGTCTTTGGTCCCCAAGCTGAGCAAGCTGATATTTTTAAAGACACAACACCATTTGCAACCTCGGTTCTAGAAGGGTTCAATGTATGTATTTTTGCATATGGTCAGACTGGGACAGGAAAAACTTTCACAATAGAGGGCACAAAAGAGGCTCAGGGTGTTAATTTCAGGACTCTTGAGAAAATGTTTGACATAATCAAGGAGAGGCATAAGCTCTACTGTTATAATATTTCTGTAAGTGTCTTAGAAGTGTACAATGAGCAAATAAGAGATTTGCTGGTTGCAGGAAATCATCCAGGAACAACTGCAAAAAGCTTATTCTATAAGTTTTTCAGAATAGTAACTGATATAGTCACTAAAATGTGGTTAATTGTAGACTTGAGATACGATAAGCTGGCACATGTGAACAATATGACTGAAGTTTGGGAAGTCCTACAAACCGGTAGCAATGCGAGGGCAGGGGAGAATTTGTTGAATGGGGAATGCACGAGAAGCAAGTTATGGCTGATGGACCTAGTAGGCAGTGAGCGAGTGGCAAAGACAGAAGTGCATGGTGATGGACTAAAGGAGACACAAAATATTAATAGGTCTCTCTCTGCACTTGGTGATGTCATATCAGCTCTTGCAACAAAAAGTTCACACATTCCTTTCAGGAACTCCAAGCTTACACACTTACTACAAGACTCATTAGGAGGAGACTCAAAGGCACTCATGTTTGTACAGATCAGTCCTAATGAAAATTATTTGAGTGAGACAATTTGCTCTCTGAACTTTGCTAGTAGAGTAAGAGGAATAGAATTGGGACCAGCAAGAAAGCAGTTAGACACTGTTGAACTTTTGAGACACAAACAAATGGTTGAGAAAGTCAAACAAGAGGTAAGGCTGAAAGATTTGCAAATCAAGAAGCTGGAGGAAACAATCCATGGATTGGAGTCCAAGATGAAGGAAAGAGACAGTAAGAACAAAAATCTCCAAGAGAAGAATGCTATCAGCAATTTTTTTTCTTCTGACAACAAATGA
Predicted protein sequences of Glyma17g20391
>Glyma17g20391.1   sequence type=predicted peptide   gene model=Glyma17g20391   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GIEDIGMEAKFKRLKRDFDSQRKKLTETRRELGEIKRENQQKSRECQEAWNSLKELQNELMCKSMHVGSLAFAIEGQVKDKSKWFSSLRNFTRKLKIMKMEHIKLLEEAEASKKYQADMREMGLIIKSKINEQLESHEDLKSKYIEGATERKDLYNKVLELRGNIRVFCHCRSFNTNEIYAGATMALDFESMKDGDLTIMSNGAPKKTFKFDVVFGPQAEQADIFKDTTPFATSVLEGFNVCIFAYGQTGTGKTFTIEGTKEAQGVNFRTLEKMFDIIKERHKLYCYNISVSVLEVYNEQIRDLLVAGNHPGTTAKSLFYKFFRIVTDIVTKMWLIVDLRYDKLAHVNNMTEVWEVLQTGSNARAGENLLNGECTRSKLWLMDLVGSERVAKTEVHGDGLKETQNINRSLSALGDVISALATKSSHIPFRNSKLTHLLQDSLGGDSKALMFVQISPNENYLSETICSLNFASRVRGIELGPARKQLDTVELLRHKQMVEKVKQEVRLKDLQIKKLEETIHGLESKMKERDSKNKNLQEKNAISNFFSSDNK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo