Glyma17g20043 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g20043

Feature Type:	gene_model
Chromosome:	Gm17
Start:	18559467
stop:	18562576
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g20043

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G09910	AT	Annotation by Michelle Graham. TAIR10: Ras-related small GTP-binding family protein \| chr5:3093272-3094932 FORWARD LENGTH=333	SoyBase	E_val: 1.00E-18	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0007264	GO-bp	Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction	SoyBase	N/A	ISS
GO:0015031	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein transport	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
GO:0008134	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transcription factor binding	SoyBase	N/A	ISS
UniRef100_G7LBB0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: GTP-binding protein, putative n=1 Tax=Medicago truncatula RepID=G7LBB0_MEDTR	SoyBase	E_val: 1.00E-20	ISS
UniRef100_I1K4R4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1K4R4_SOYBN	SoyBase	E_val: 4.00E-34	ISS

Expression Patterns of Glyma17g20043

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g20043 not represented in the dataset	Glyma17g20043 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g20043 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g174700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g20043

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g20043

Limit To All Plant Sequences

>Glyma17g20043.1   sequence type=CDS   gene model=Glyma17g20043   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGTGGCAAATCATGTCTTATAAAATTAGATGCAGAGATTTGCCCTGTTTTTGCATTTTGTTGAATGGTTTCCATCCAATTTATTCTTCTTATAATGGTTGTGATTTTTATGTTGGACATCTACAGGCTGCCAAAGAAGCAAGGCATGATAAGGAGGCTCTGGTGAAATTTTTCTGCATGTTGATCAGGAGAAGATATTTCTCAGATGAAATACAAATACCTTCACCAGCATGGTCCATTCCTTCTGTTCAGAGACAAGCTCAGCGTATAGATGAAAATTTCACAGAAGATGATCAATCTTATAATACAAGGCTAAGGTGA

Predicted protein sequences of Glyma17g20043

Limit To All Plant Sequences

>Glyma17g20043.1   sequence type=predicted peptide   gene model=Glyma17g20043   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKWQIMSYKIRCRDLPCFCILLNGFHPIYSSYNGCDFYVGHLQAAKEARHDKEALVKFFCMLIRRRYFSDEIQIPSPAWSIPSVQRQAQRIDENFTEDDQSYNTRLR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain