SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g17370

Feature Type:gene_model
Chromosome:Gm17
Start:14189979
stop:14199664
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g17370
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G67580AT Annotation by Michelle Graham. TAIR10: Homeodomain-like/winged-helix DNA-binding family protein | chr5:26955843-26957073 REVERSE LENGTH=299 SoyBaseE_val: 7.00E-74ISS
GO:0006334GO-bp Annotation by Michelle Graham. GO Biological Process: nucleosome assembly SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003691GO-mf Annotation by Michelle Graham. GO Molecular Function: double-stranded telomeric DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0042162GO-mf Annotation by Michelle Graham. GO Molecular Function: telomeric DNA binding SoyBaseN/AISS
GO:0042803GO-mf Annotation by Michelle Graham. GO Molecular Function: protein homodimerization activity SoyBaseN/AISS
GO:0043047GO-mf Annotation by Michelle Graham. GO Molecular Function: single-stranded telomeric DNA binding SoyBaseN/AISS
PTHR21717Panther TELOMERIC REPEAT BINDING PROTEIN JGI ISS
PTHR21717:SF9Panther TELOMERIC REPEAT BINDING PROTEIN 1 JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
PF00538PFAM linker histone H1 and H5 family JGI ISS
UniRef100_I1MVK8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MVK8_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q0PJK3UniRef Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor MYB85 n=1 Tax=Glycine max RepID=Q0PJK3_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma17g17370
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g17370
ParalogEvidenceComments
Glyma05g22500 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g17370 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g160500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g17370
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g17370
>Glyma17g17370.1   sequence type=CDS   gene model=Glyma17g17370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTGCTCCTAAGCAGAAATGGACTGCGGAAGAAGAAGCGGCACTGAAAGCTGGTGTACTCAAGCATGGGGCAGGAAAATGGCGCACCATACTTACAGATCCTGAGTTCAGTGCCATTTTGCATATGCGTTCGAATGTAGATCTTAAGGATAAATGGAGGAATATAAACGTGACAGCGATATGGGGATCCCGGCAGAAGGCAAAGCTTGCTCTTAAAAGGAACCTGCCAGCCCCCAAAATTGACAATAACCATATGGCCTTGAGTACCGTAGTTCGACATGATGAAGTTCTTGATACTAAACCCTTGGCAGTTTCTGGTGGACCATTGCAATCTACCAATTTGAAAGAACAAATATCTAGGTTGGTGGATAATCATATATTAGAGGCAATTGTCTACATGAAGGAGCAAAAGGGTTCTGACAAGGCTGCCATTGCTTCTTTCATAGAGGAAAAATATCGGTTTCCACCAAATCTCAGTAAACTACTGCCAGCCAAACTGAAGCATATGGTGGCAAGTGGCAAAATAATCAAGGAAAAGCATAAGTACAGGATTGCGCCAAGTTCAACAGTCTCTGAGAAAAGAAGATGCTCTTCATTGGTACTTTTGGAAGACAGGCCCAAAGATCCTTCAGAAGCACATAAGAATGATGATGTCAACATCCTTTTAAAATCCCAAATTGATGCAGAGATATCAAAAGTGAAGGGCTTGACAGCTCAAGAGGCAGCTGCTGCGGCTGCAAAAGCAGTTGCGGAGGCAGAGACTGCAATTGCACAGGCTGAGGCAGCAGCTAGGGAGGCAGAGGCTGCAGAAGCTGAGGCTGAGGCTGCTCAAGTGTTTGCAAAAGCAGCAATGAAGGCGCTAAAATGCAAAATGCTTCATATTTGA
Predicted protein sequences of Glyma17g17370
>Glyma17g17370.1   sequence type=predicted peptide   gene model=Glyma17g17370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGAPKQKWTAEEEAALKAGVLKHGAGKWRTILTDPEFSAILHMRSNVDLKDKWRNINVTAIWGSRQKAKLALKRNLPAPKIDNNHMALSTVVRHDEVLDTKPLAVSGGPLQSTNLKEQISRLVDNHILEAIVYMKEQKGSDKAAIASFIEEKYRFPPNLSKLLPAKLKHMVASGKIIKEKHKYRIAPSSTVSEKRRCSSLVLLEDRPKDPSEAHKNDDVNILLKSQIDAEISKVKGLTAQEAAAAAAKAVAEAETAIAQAEAAAREAEAAEAEAEAAQVFAKAAMKALKCKMLHI*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo